Articles

BINARY VECTOR CONSTRUCTION OF KAPPA(κ)-CARRAGEENASE GENE AND TRANSFORMATION TO AGROBACTERIUM TUMEFACIENS AS MEDIATOR FOR SEAWEED TRANSGENIC GENERATION Rajamuddin, Muh Alias L.; Alimuddin, .; Widyastuti, Utut; Harris, Enang; Suryati, Emma
Jurnal Ilmu dan Teknologi Kelautan Tropis Vol. 8 No. 1 (2016): Elektronik Jurnal Ilmu dan Teknologi Kelautan Tropis
Publisher : Department of Marine Science and Technology, Faculty of Fisheries and Marine Science, IPB University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (852.637 KB) | DOI: 10.29244/jitkt.v8i1.13602

Abstract

Increasing of kappa (?)-carrageenan content in Kappaphycus alvarezii seaweed is potentially be achieved by applying transgenesis technology. This study was performed to obtain a construction of  ?-Carrageenase gene and Agrobacterium tumefaciens to carry those construction genes.  The ?-Carrageenase (?-Car) gene was involved in ?-carrageenan biosynthesis. The ?-Car gene sequence was ligated between the 35S CaMV promoter and tNos terminator sequences to generate pMSH/?-Car expression vector. Transformation of pMSH/?-Car plasmid to Escherichia coli was performed by heat-shock method, and to Agrobacterium tumefaciens by tri-parental mating method. The results showed that several colonies of E. coli and A. tumefaciens grew in the selective culture mediums containing antibiotic. PCR analysis using primers 35S-Forward and tNos-Reverse with DNA template from those bacterial colonies resulted DNA fragment of about 2,000 bp, the same as the total length of 35S CaMV promoter, ?-Car gene and tNos terminator sequences. Therefore, the construction of pMSH/?-Car gene was succeeded and a colony of A. tumefaciens transformant carrying pMSH/?-Car plasmid was successfully produced.                                                                                   Keywords:  Agrobacterium tumefaciens, kappa(?)-Carrageenase gene, transgenesis, vector
EVALUATION OF MICROBIAL FLOC AND MICROALGAE SPIRULINA PLATENSIS COMBINATION FOR JUVENILE COBIA RACHYCENTRON CANADUM DIETS ON GROWTH AND PHYSIOLOGICAL RESPONSES AFTER IMMERSION IN FRESHWATER Saputra, Suryadi; Suprayudi, Muhammad Agus; Harris, Enang; Setiawati, Mia; Widanarni, .; antoro, Suci
Jurnal Ilmu dan Teknologi Kelautan Tropis Vol. 8 No. 1 (2016): Elektronik Jurnal Ilmu dan Teknologi Kelautan Tropis
Publisher : Department of Marine Science and Technology, Faculty of Fisheries and Marine Science, IPB University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (215.136 KB) | DOI: 10.29244/jitkt.v8i1.13084

Abstract

In marine aquaculture, immersing marine fish species in fresh water can remove ectoparasite that adhere to all over the fish body. This study aimed to evaluate the impacts of combining microbial floc and microalgae Spirulina platensis in juvenile cobia diet on growth performance and stress responses after immersion in aerated fresh water for 15 minutes. The fishes were reared in concrete tanks for 40 days before collecting data on their growth performance. The stress response was determined by mea-suring both glucose and cortisol levels before (0 h) and after (1, 2, 4, 6, 24 hours) immersion. The fish-es fed on the 15% of combining microbial flock and microalgae Spirulina platensis diet showed the highest growth rate with the lowest feed conversion ratio compared to other treatments. The cortisol level of juvenile cobia in both the 15% and 30% combination of microbial floc and microalgae Spiru-lina platensis treatments did not increase during the first hour following the immersion compared to the control treatment. The glucose level also increased after one hour immersion in freshwater of all treatments. This indicated that feeding juvenile cobia on microbial flocs and microalgae diets had a retarding effect on the physiological responses (cortisol and glucose) after immersion in fresh water.Keywords: microbial, microalga, Spirulina, glucose, cortisol, stress, cobia
KARAKTERISTIK DAN PATOGENISITAS STREPTOCOCCUS AGALACTIAE TIPE ?-HEMOLITIK DAN NON-HEMOLITIK PADA IKAN NILA Handayani Hardi, Esti; -, Sukenda; Harris, Enang; Mariana Lusiastuti, Angela
Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Streptococcus agalactiae was isolated from cultured Nile tilapia (Oreochromis niloticus) in Cirata gulfand Klaten. The isolates were Gram positive cocci, oxidative fermentative positive, motility, and catalasenegative, grown on media containing NaCl 6.5%, ?-haemolytic and non-haemolytic. Two types of S. agalactiae(?-haemolytic and non-haemolytic) are different from their variety of sugars fermentation. Strains ?-haemolytic can ferment more sugars, including arabinose, sorbitol, lactose, and trehalose. Experimentalinfectivity trials on Nile tilapia (size 15 g), non-haemolytic type showed more virulent. This type causedfaster mortality, more severe behavior changes, and pathology changes than â-haemolytic type. NonhemoliticS. agalactiae caused 48% mortality 6-24 hours after injection, whereas â-haemolitic type caused17% mortality which it occured in 48 hours after injection (mortality of fish control 2,22%). Behaviordisease signs caused by non-haemolitic S. agalactiae started to happen 6 hours after injection whereas 12hours in ?-haemolytic type infection. Histopatological changes were observed on fish eye, spleen, andbrain. Hyperaemia, hyperthrophi, degeneration, and necrosis were also found on infected fish. Thisresearch was concluded that non-haemolytic of S. agalactiae was more virulent than ?-haemolytic.
THE EFFECTIVENESS OF LEMNA PERPUSILLA AS PHYTOREMEDIATION AGENT IN GIANT GOURAMI CULTURE MEDIA ON 3 PPT Marda, Alexander Burhani; Nirmala, Kukuh; Harris, Enang; Supriyono, Eddy
Jurnal Akuakultur Indonesia Vol. 14 No. 2 (2015): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3077.813 KB) | DOI: 10.19027/jai.14.122-127

Abstract

ABSTRACT The wasted from feed and feces containt nitrogen and phosphorus can decreased fertility and feability water quality. Lemna perpusilla (duckweed) is prospective to use as an agent of phytoremediation of organic waste and can used as animal feed because it has high protein content. Meanwhile water salinity could be accelerate the growth of giant gourami. The aim of this research was to analyze the ability of L. perpusilla in absorbing nutrients nitrogen and phosphorus in water salinity of 3 ppt. The research was conducted four treatments and three replications. The treatments were A (L. perpusilla and 3 ppt salinity), B (L. perpusilla, 3 ppt salinity and filter), C (L. perpusilla, 3 ppt salinity and aeration), and D (L. perpusilla, 3 ppt salinity, filter and aeration). Experiment were carried in aquaria 50×33×50 cm3 in size with density of gourami fish 150/49.5 L for one month. The results showed that the ability of L. perpusilla to absorb N and P decreased from the beginning of the study due to lack of nutrient source of N and P in the aquaculture media, but increased because the impact of the feeding and  metabolism of the gourami. There was no different treatment effect for decreased N and P (P> 0.05). The highest nitrite level was found in D treatment, it means that L. perpusilla not be able to absorb  N and P in the media 3 ppt salinity. However, the addition of 3 ppt salinity gives the best results for the survival rate and feed efficiency ratio. Keywords: phytoremediation, Lemna perpusilla, giant gourami fish, nitrogen and phosphorus  ABSTRAK Limbah pakan dan feses yang mengandung nitrogen dan fosfor dapat menyebabkan penurunan kesuburan dan kelayakan kualitas air. Lemna perpusilla (duckweed) baik digunakan sebagai agen fitoremediasi organik untuk limbah dan dapat digunakan sebagai pakan hewan karena mengandung protein yang tinggi, sementara media bersalinitas mampu mempercepat pertumbuhan ikan gurami. Tujuan dari penelitian ini adalah untuk menganalisis kemampuan L. perpusilla dalam mengabsorbsi nutrisi nitrogen dan fosfor pada air bersalinitas 3 ppt. Penelitian ini terdiri atas lima perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah A (L. perpusilla dan salinitas 3 ppt), B (L. perpusilla, salinitas 3 ppt dan filter), C (L. perpusilla, salinitas 3 ppt dan aerasi), dan D (L. perpusilla, salinitas 3 ppt, aerasi dan filter). Akuarium yang digunakan berukuran 50×33×50 cm3 dengan kepadatan ikan gurami 150 ekor/49,5 L dan waktu pemeliharaan selama satu bulan. Hasil penelitian ini menunjukkan bahwa kemampuan L. perpusilla menyerap limbah N dan P berkurang dari awal penelitian karena kurangnya sumber nutrisi N dan P pada media pemeliharaan, namun beranjak meningkat yang berdampak dari adanya pemberian pakan dan sisa metabolisme dari ikan gurame. Tidak ada perlakuan yang berpengaruh terhadap pengurangan N dan P (P>0,05). Nilai nitrit tertinggi terdapat pada perlakuan D, hal ini berarti bahwa L. perpusilla tidak mampu untuk menyerap limbah N dan P pada media bersalinitas 3 ppt. Namun penambahan salinitas 3 ppt memberikan hasil yang terbaik bagi derajat kelangsungan hidup ikan gurami dan efisiensi pakan. Kata kunci: fitoremediasi, Lemna perpusilla, ikan gurami, nitrogen dan fosfor 
PEMBERIAN FIKOSIANIN SPIRULINA MENINGKATKAN JUMLAH SEL DARAH, AKTIVITAS FAGOSITOSIS, DAN PERTUMBUHAN IKAN KERAPU BEBEK JUVENIL (ADMINISTRATION OF SPIRULINA PHYCOCYANIN ENHANCES BLOOD CELLS, PHAGOCYTIC ACTIVITY AND GROWTH IN HUMPBACK GROUPER JUVENILE) Satyantini, Woro Hastuti; ., Sukenda; Harris, Enang; Utomo, Nur Bambang Priyo
Jurnal Veteriner Vol 15 No 1 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The aim of this study was to investigate effects of Spirulina phycocyanin on the total  blood cell count,phagocytic activity, and growth of humpback grouper fish, Cromileptes altivelis juvenil.  Fishes were fedwith a diet containing   0, 150, 250, 350 dan 450 mg  phycocyanin per kg diet for four weeks and eachtreatment was triplicates.  Initial body weight  of  grouper was  8.46 ± 0.22 g with a density of 10 fish per56 litre volume. The total count of  erythrocytes and leucocytes increased until the fourth week of rearingperiod. The highest of total erythrocyte and leucocytes were observed in fish treated with 150 mg phycocyaninper kg diet ( 13.17 x  105 cells/mm3 and 8.93 x 105 cells/mm3 respectively) which were not significantlydifferent (P>0.05) to those treated with 250 mg phycocyanin per kg diet. The total leucocytes and phagocyticactivity of fish fed diet containing  250 mg phycocyanin  per kg diet (8.49 x 105 cells/mm3 and 59.67%respectively) were significantly higher  (P <0.05) to those of control group. The highest of final weight(Wt=14.32 g) and weight growth (G=5.89g) and lowest of feed conversion ratio (FCR=1.13) were obtainedin fish treated with  250 mg phycocyanin per kg diet which were  significantly  higher  (P <0.05) than thosefed control diet. The data showed that  the addition of  phycocyanin 250 mg/kg diet enhances the totalleukocyte count, phagocytic activity and the growth of humpback grouper juvenil.
MOLECULAR IDENTIFICATION OF PATHOGENIC BACTERIA AND PCR SPECIFIC PRIMER DESIGN Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5?-CAG GCC TAA CAC ATG CAA GTC-3?) and reverse primer 1387r (5?-GGG CGG WGT GTA CAA GGC-3?). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
TOKSISITAS PRODUK EKSTRASELLULAR (ECP) STREPTOCOCCUS AGALACTIAE PADA IKAN NILA (OREOCHROMIS NILOTICUS) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (919.679 KB) | DOI: 10.31258/jnat.13.3.187-199

Abstract

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: ?-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and ?-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae ?-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas ?-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than ?-haemolytic type.The conclusion from the research that ECP was virulent factor on ?-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.
ENHANCEMENT OF NON-SPECIFIC IMMUNE RESPONSE, RESISTANCE AND GROWTH OF (LITOPENAEUS VANNAMEI) BY ORAL ADMINISTRATION OF NUCLEOTIDE Manoppo, Henky; Sukenda, .; Djokosetiyanto, Daniel; Sukadi, Mochamad Fatuchri; Harris, Enang
Jurnal Akuakultur Indonesia Vol. 10 No. 1 (2011): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (207.428 KB) | DOI: 10.19027/jai.10.1-7

Abstract

This research evaluated the nonspecific immune responsse, resistance, and growth of Litopenaeus vannamei fed nucleotide diet. Shrimp juveniles (mean weight 5.39±0.56 g) were reared in two groups of glass aquaria, each with three replications. Shrimps in group one and group two were fed nucleotide diet and basal diet each for four weeks. Total haemocyte count (THC) and PO activity were evaluated at the end of feeding while growth was measured at two weeks interval. At the end of feeding trial, the shrimps were intramuscularly injected with Vibrio harveyi 0.1x106 cfu.shrimp-1. THC of shrimp fed nucleotide diet significantly increased (P
APPLICATION OF GAMAL GLIRICIDIA SEPIUM LEAVES COMPOST AS DEPURATION AGENT OF LEADS (PB) IN THE BODY ORGAN OF RED TILAPIA OREOCHROMIS SP. Robin, ,; Nirmala, Kukuh; Harris, Enang; Affandi, Ridwan; Jusadi, Dedi
Jurnal Akuakultur Indonesia Vol. 16 No. 1 (2017): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3275.112 KB) | DOI: 10.19027/jai.16.1.83-91

Abstract

ABSTRACT  This study was aimed to perform depuration of Pb contained in tilapia body. The experiments were conducted in aquarium using compost of Gliricidia sepium leaf at a concentration of 10g/L, 20 g/L, 30 g/L, 40 g/L, and 0 g/L (control). The result showed that Pb level in fish muscle immersed with compost of Gliricidia leaf at a dose of 30 g/L for five days successfully decreased to a safe limit for human consumption (<0.3 mg/kg). However, decrease of Pb level in fish liver and kidney to finally reach the safe limit required seven days. Decreasing level of lead in the organs of experimental fish along with the increasing level of Pb in compost and maintenance media indicated that Pb accumulated in fish were released into the maintenance media by compost through chelation process. To conclude, compost of G. sepium leaves can be used as the material for depuration of Pb in the body of tilapia Keywords: humic acid, fulvic acid, depuration, Gliricidia leaves, lead, red tilapia  ABSTRAK  Penelitian ini bertujuan untuk mendepurasi Pb yang terkandung di tubuh ikan nila. Percobaan dilakukan di dalam akuarium menggunakan kompos daun gamal pada konsentrasi 10 g/L, 20 g/L, 30 g/L, 40 g/L, dan 0 g/L (kontrol). Hasil penelitian menunjukkan bahwa, Pb di daging ikan yang direndam dengan kompos daun gamal pada konsentrasi 30 g/L selama lima hari, kadarnya menurun hingga batas aman untuk dikonsumsi manusia (<0,3 mg/ kg). Penurunan Pb di hati dan ginjal untuk mencapai kadar aman membutuhkan waktu yang lebih lama, yakni tujuh hari. Seiring dengan menurunnya kadar Pb dalam organ ikan uji, kisaran Pb dalam kompos dan media budidaya meningkat, menunjukkan bahwa Pb dari tubuh ikan dilepaskan ke media budidaya dan terjadi proses khelat oleh kompos. Dengan demikian, kompos daun gamal bisa digunakan sebagai bahan pendepurasi Pb dari tubuh ikan nila. Kata kunci: asam humat, asam fulvik, depurasi, daun gamal, timbal, nila merah
BIOFLOC TECHNOLOGY ON THE INTENSIVE AQUACULTURE OF BRONZE CORYDORAS ORNAMENTAL FISH CORYDORAS AENEUS WITH DIFFERENT STOCKING DENSITIES Diatin, Iis; Suprayudi, Muhammad Agus; Budiardi, Tatag; Harris, Enang; Widanarni, Widanarni
Jurnal Akuakultur Indonesia Vol. 18 No. 2 (2019): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3552.973 KB) | DOI: 10.19027/jai.18.2.202-213

Abstract

ABSTRACT Ornamental fish is non consumption fish which is an important source of Indonesian foreign exchange. The objective of this study is to analyze the productivity of bronze corydoras Corydoras aeneus ornamental fish through increased stocking density with biofloc technology. The average weight of the experimental corydoras was 0.61 ?0.72 g with 2.32?2.40 cm standard length. This study used a randomized design method with biofloc technology treatment in 3000, 4500, and 6000 fish/m2 stocking densities. The results showed that the daily length and weight-growth rate among treatments were not significantly different (P>0.05), while survival rate and the number of fish production on all treatments were significantly different (P<0.05). The water quality during the rearing period, such as temperature, pH, alkalinity, ammonia, nitrite, and nitrate, were in a tolerable range for corydoras culture. The total suspended solids tended to be higher due to higher stocking density. The best productivity using biofloc technology obtained from 6000 fish/m2 stocking density. Keywords: Biofloc technology, Corydoras aeneus, growth rate, stocking density, survival rate. ABSTRAK Ikan hias merupakan produk perikanan non konsumsi yang menjadi sumber devisa Indonesia yang cukup penting. Penelitian ini bertujuan untuk menganalisis produktivitas ikan hias koridoras melalui peningkatan padat tebar dengan teknologi bioflok. Ikan yang digunakan adalah ikan hias koridoras (Corydoras aeneus) berbobot 0,61?0,72 g dan panjang baku 2,32?2,40 cm. Penelitian ini menggunakan rancangan acak lengkap dengan perlakuan teknologi bioflok pada padat tebar 3000, 4500, dan 6000 ekor/m2. Hasil penelitian menunjukkan bahwa laju pertumbuhan harian panjang dan bobot antar perlakuan tidak berbeda nyata (P>0,05), sedangkan kelangsungan hidup dan jumlah produksi ikan pada semua perlakuan berbeda nyata (P<0,05). Nilai kualitas air selama pemeliharaan yakni suhu, pH, alkalinitas, amonia, nitrit, dan nitrat yang berada pada kisaran yang cukup baik untuk budidaya ikan. Total padatan tersuspensi cenderung tinggi akibat dari semakin tinggi padat tebar. Produktivitas terbaik pada budidaya ikan koridoras dengan teknologi bioflok adalah pada padat tebar 6000 ekor/m2. Kata kunci:  Corydoras aeneus, kelangsungan hidup, padat tebar, pertumbuhan, teknologi bioflok