p-Index From 2015 - 2020
13.816
P-Index
This Author published in this journals
All Journal VALENSI Cakrawala Pendidikan INERSIA voteknika Jurnal Lahan Suboptimal Jurnal Pendidikan dan Pembelajaran Jurnal Kedokteran Syiah Kuala HOLISTIC STUDIA ISLAMIKA Berita Kedokteran Masyarakat TELKOMNIKA Telecommunication, Computing, Electronics and Control JEJAK JURNAL KEDOKTERAN DAN KESEHATAN Prosiding Universitas PGRI Palembang ISLAMICA: Jurnal Studi Keislaman Jurnal Ilmu-Ilmu Pertanian Indonesia Marwah: Jurnal Perempuan, Agama dan Gender Jurnal Teknologi Informasi Komunikasi Pendidikan Jurnal Kesehatan Andalas Jurnal Adabiya SEL Jurnal Penelitian Kesehatan INTEKNA Jurnal Perlindungan Tanaman Indonesia Jurnal Pendidikan Ilmu Sosial HUMAN FALAH: Jurnal Ekonomi dan Bisnis Islam Sriwijaya Journal of Environment Indonesian Journal of Fundamental and Applied Chemistry Jurnal Kimia Riset KAREBA : Jurnal Ilmu Komunikasi JURNAL PUSTAKA BUDAYA Biomedical Journal of Indonesia Economics Development Analysis Journal Science and Technology Indonesia Jurnal Penelitian Sains Jurnal Abdimas BSI: Jurnal Pengabdian Kepada Masyarakat Jurnal Kesehatan Masyarakat Aceh Jurnal Ilmu Keperawatan Jurnal Hukum Mimbar Justitia Al-Albab EnviroScienteae AcTion: Aceh Nutrition Journal MUST: Journal of Mathematics Education, Science and Technology IT JOURNAL RESEARCH AND DEVELOPMENT JOURNAL OF CIVIL ENGINEERING, BUILDING AND TRANSPORTATION JURNAL BAHASA, SASTRA DAN PEMBELAJARANNYA Indonesian Journal of Chemistry Indonesian Journal of Pure and Applied Chemistry Jurnal Elementary : Kajian Teori dan Hasil Penelitian Pendidikan Sekolah Dasar Jurnal Ilmu Budaya AICLL: ANNUAL INTERNATIONAL CONFERENCE ON LANGUAGE AND LITERATURE NUR EL-ISLAM : Jurnal Pendidikan dan Sosial Keagamaan SENTIA 2015 ESTEEM : Journal of English Study Programme Jurnal Ilmiah Administrasita' Khatulistiwa Jurnal Pendidikan Fisika dan Teknologi Jurnal Ilmiah Mandala Education (JIME) JISIP: Jurnal Ilmu Sosial dan Pendidikan JUPE : Jurnal Pendidikan Mandala Jurnal TAMBORA Molekul: Jurnal Ilmiah Kimia RELIGIA Jurnal Ilmu dan Teknologi Kesehatan Matriks Teknik Sipil Jurnal Farmasi Higea PROSIDING SEMINAR NASIONAL LEMBAGA PENELITIAN DAN PENDIDIKAN (LPP) MANDALA JOISIE (Journal Of Information Systems And Informatics Engineering) Transparansi Jurnal Ilmiah Ilmu Administrasi Jurnal Ilmu dan Teknologi Peternakan Indonesia (JITPI) JURNAL MEDIA KESEHATAN Jurnal Elektronik WACANA ETNIK Jurnal Gema Ngabdi Syntax Idea Akta Agrosia Jurnal Teknologi Elekterika Journal Civics and Social Studies JURNAL PIONIR Jurnal Sisfotek Global Asian Journal of Applied Research, Community Development and Empowerment (AJARCDE) Mu'amalat: Jurnal Kajian Hukum Ekonomi Syariah International Journal of Recent Technology and Applied Science (IJORTAS) Aspirasi : Jurnal Masalah-masalah Sosial Al Qisthi: Jurnal Sosial dan Politik
Articles

An Early Detection Method of Type-2 Diabetes Mellitus in Public Hospital Adhi Tama, Bayu; F. S., Rodiyatul; Hermansyah, Hermansyah
TELKOMNIKA Telecommunication, Computing, Electronics and Control Vol 9, No 2: August 2011
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (51.295 KB)

Abstract

Diabetes is a chronic disease and major problem of morbidity and mortality in developing countries. The International Diabetes Federation estimates that 285 million people around the world have diabetes. This total is expected to rise to 438 million within 20 years. Type-2 diabetes mellitus (T2DM) is the most common type of diabetes and accounts for 90-95% of all diabetes. Detection of T2DM from various factors or symptoms became an issue which was not free from false presumptions accompanied by unpredictable effects. According to this context, data mining and machine learning could be used as an alternative way help us in knowledge discovery from data. We applied several learning methods, such as instance based learners, naive bayes, decision tree, support vector machines, and boosted algorithm acquire information from historical data of patients medical records of Mohammad Hoesin public hospital in Southern Sumatera. Rules are extracted from Decision tree to offer decision-making support through early detection of T2DM for clinicians.
THE ROLE OF VISUAL AIDS IN TEACHING ENGLISH Hermansyah, Hermansyah
Jurnal Dosen Universitas PGRI Palembang KUMPULAN JURNAL DOSEN UNIVERSITAS PGRI PALEMBANG EDISI 6
Publisher : Jurnal Dosen Universitas PGRI Palembang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

This paper focused on the role of visual aids in teaching English. A visual aid is an object or representation that may be used to clarify or enhance understanding of a concept or process.The role of visual aids are : (1) Visual aids are learning tools that educators and presenters use to convey an idea more effectively, (2) visual aids is that they help an audience use their visual capacity, (3) Visual aids are key tools in learning and development since they help increase a student's interest in a subject, (4) that they enhance learning because interactive effects can be used to reinforce the material learned, and (5) Visual aids help emphasize a point, which is another benefit to using them. The use visual aids can be benefical if the role of teacher used it actively.
PENGARUH LINGKUNGAN BELAJAR DI SEKOLAH TERHADAP MOTIVASI BELAJAR SISWA SMK MANDIRI PONTIANAK Hermansyah, Hermansyah; Sulistyarini, Sulistyarini; Genji, Bambang
Jurnal Pendidikan dan Pembelajaran Khatulistiwa Vol 7, No 4 (2018): April 2018
Publisher : Jurnal Pendidikan dan Pembelajaran Khatulistiwa

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (333.361 KB)

Abstract

AbstractThis thesis entitled "the influence of learning environment in school toward the students?learning motivation at SMK Mandiri Pontianak" common problem in this research is "whether there is influence of learning environment in school to the students? learning motivation at SMK Mandiri Pontianak". The method used in this research is descriptive method in the form of correlation studies. The populations in this study were all students of class XI and XII which amounted to 230 students, the sample taken using random sample totaling 146 students. Data collection used questionnaire / questionnaire techniques, and documentation techniques. The results showed that there is influence between independent variable (X) to the dependent variable (Y) which is known through the calculation by using simple linear regression equation formula Y = a + bX then it is shown in Y = 9,615 + 0,858X which means the value of constant is 9,615 if the learning environment (X) is 0 (zero), then the learning motivation (Y) is worth 9,615. The regression coefficient value of the learning environment variable (X) is 0.858. This means that every improvement of learning environment (X) is 1, then the learning motivation (Y) will increase by 0.858 and test the t test hypothesis> t table, because the value of t arithmetic> t table is 20.650> 1.976 then Ha accepted and Ho rejected or "there is influence of learning environment in school to students? motivation learning at SMK Mandiri Pontianak". Keywords: Environment Learning, Motivation Learning 
Pengaruh Penggunaan Laboratorium Virtual Terhadap Penguasaan Konsep dan Kemampuan Berpikir Kreatif Siswa pada Materi Getaran dan Gelombang Hermansyah, Hermansyah; Gunawan, Gunawan; Herayanti, Lovy
Jurnal Pendidikan Fisika dan Teknologi Vol 1, No 2 (2015): April
Publisher : FKIP Universitas Mataram

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (693.218 KB) | DOI: 10.29303/jpft.v1i2.242

Abstract

This research aims to know the effect of using virtual laboratorial towards concept mastery and creative thinking ability of students on the material of vibrations and waves. This research is an experimental research that uses pretest-postest control group design. The population of this research is all grade VIII students of SMPN 1 Alas Barat in the academic year 2013/2014 and the sample of this research is grade VIII3 as experimental group and VIII4 as control group that determined by cluster random sampling technique. The instrument thet used to collect the data is test that made in terms of multiple choices and essay test. The data is analysed by statistical formula of N-Gain and t-test. The result of N-Gain of experimental group concepts mastery is 0,5% and control group is 0,2%. Meanwhile, the result of N-Gain of experimental group creative thinking ability is 0,3% and control group is 0,1%. The resultof t-test shows that tobtined of concepts mastery is 1,877 ≥ ttable is 1,671. Whereas, for creative thinking ability shows that tobtined is 1,998 ≥ ttable is 1,671. It means that there is a difference of concept mastery and creative thinking ability of students on the material of vibrations and waves. Therefore, it can be concluded that the use of virtual laboratorial has an effect towards concept mastery and creative thinking ability of students on the material of vibrations and waves.
Pengaruh Pupuk Organik Limbah Kelapa Sawit dan Pupuk Anorganik terhadap Pertumbuhan Bibit Kelapa Sawit (Elaeis guineensis Jacq.) pada Pembibitan Utama Hidayat, Kgs Agus Taufik; Saleh, Busri; Hermansyah, Hermansyah
Akta Agrosia Vol 20, No 1 (2017)
Publisher : Faculty of Agriculture, The University of Bengkulu

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (860.96 KB) | DOI: 10.31186/aa.20.1.1-8

Abstract

Palm oil mill waste is one of the biggest problems in palm oil mill development, hence the need for technology to treat the waste in order to be utilized. This study aims to obtain the composition of organic fertilizer solid waste palm oil factory combined with inorganic fertilizer in the main seedling of oil palm, carried out in the nursery garden of PT. Bio Nusantara Teknologi, Kec. Pondok Kelapa, Central Bengkulu District, from January 2016 to April 2016 with a height of 13 meters above sea level, using Completely Randomized Design (RCD), a factor with 4 replications. Dosage of combination Organic Fertilizer (POP) and Inorganic Fertilizer consisting of 6 levels, namely: O0 = 100% Inorganic (50 g / polybag) + 0% Organic (0 g / polybag), O1 = 80% Inorganic (40 g / polybag) + 20% Organic (100 g / polybag), O2 = 60% Inorganic (30 g / polybag) + 40% Organic (200 g / polybag), O3 = 40% Inorganic (20 g / polybag) + 60% Organic (300 g / polybag), O4 = 20% Inorganic (10 g / polybag) + 80% Organic (400 g / polybag), O5 = 0% Inorganic (0 g / polybag) + 100% Organic (500 g / polybag) ). The results showed that the combination of fertilizer treatment was significantly different from the variability of green leaves, the increase of seedlings 12 weeks after planting (MST), stem diameter 12 MST and leaf-breaking time, and not significantly different on the leaves leaf variable 12 MST.Keywords: palm oil waste,  solid organic fertilizer,  inorganic fertilizer,  palm oil nursery 
ANALISIS KINERJA SIMPANG BERSINYAL (STUDI KASUS JALAN HASANUDDIN-JALAN KAMBOJA, SUMBAWA BESAR) Suryaningsih, Oyi Febri; Hermansyah, Hermansyah; Kurniati, Eti
INformasi dan Ekspose hasil Riset Teknik SIpil dan Arsitektur Vol 16, No 1 (2020): MEI
Publisher : Universitas Negeri Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (520.919 KB) | DOI: 10.21831/inersia.v16i1.31317

Abstract

ABSTRAKMeningkatnya jumlah penduduk di Kabupaten Sumbawa menyebabkan meningkatnya juga pertumbuhan kendaraan pribadi. Pertumbuhan kendaraan pribadi yang tinggi bisa menyebabkan kemacetan salah satunya di Simpang Jalan Hasanuddin-Jalan Kamboja yang sering terjadi tundaan kendaraan pada jam sibuk. Kawasan ini termasuk dalam kawasan yang padat karena merupakan kawasan pusat perdagangan, perkantoran, dan pendidikan. Tujuan penelitian ini adalah untuk menganalisis kinerja tingkat pelayanan persimpangan Jalan Hasanuddin-Jalan Kamboja melalui evaluasi kinerja simpang bersinyal berdasarkan analisis waktu sinyal, kapasitas, derajat kejenuhan dan tingkat pelayanan simpang dengan menggunakan metode MKJI 1997. Berdasarkan hasil analisis yang dilakukan diperoleh tingkat pelayanan simpang berada pada level C (arus stabil tetapi kecepatan dibatasi) yaitu Derajat Kejenuhan untuk Pendekat Barat, Selatan dan Timur sebesar 0,53, 0,55 dan 0,56. Hal ini menandakan bahwa simpang bersinyal tersebut masih cukup baik karena Derajat Kejenuhan masih berada dibawah angka 0,75. Kata Kunci: derajat kejenuhan, MKJI 1997, simpang bersinyal, tingkat pelayanan simpang  ABSTRACTThe increasing number of population in Sumbawa Regency also increases the growth of private vehicles. High growth of private vehicles can cause traffic jams, one of which is at the Hasanuddin-Cambodia Road Junction which often causes vehicle delays during rush hour. This area is included in a dense area because it is a center of trade, offices, and education. The purpose of this study is to analyze the performance level of the intersection of Hasanuddin Road and Jalan Cambodia through the evaluation of the performance of signal intersections based on the analysis of signal time, capacity, degree of saturation and level of intersection services using the MKJI 1997 method. at level C (current is stable but speed is limited), namely the Degree of Saturation for the West, South and East Approaches of 0.53, 0.55 and 0.56. This indicates that the signaled intersection is still quite good because the degree of saturation is still below the 0.75 figure. Keyword: degree of saturation, MKJI 1997, signed intersection, road services level
TRANSCRIPTION OF CELL WALL MANNOPROTEINS-1 GENE IN SACCHAROMYCES CEREVISIAE MUTANT Hermansyah, Hermansyah
Jurnal Kimia Valensi Jurnal Kimia VALENSI Volume 4, No. 2, November 2018
Publisher : Lembaga Penelitian dan Pengabdian Kepada Masyarakat Syarif Hidayatullah State Islamic Uni

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1038.502 KB) | DOI: 10.15408/jkv.v4i2.7367

Abstract

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases.  The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role.  In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101).  A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR?s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.  
GUIDED INQUIRY MODEL THROUGH VIRTUAL LABORATORY TO ENHANCE STUDENTS' SCIENCE PROCESS SKILLS ON HEAT CONCEPT Gunawan, Gunawan; Harjono, Ahmad; Hermansyah, Hermansyah; Herayanti, Lovy
Jurnal Cakrawala Pendidikan CAKRAWALA PENDIDIKAN, VOL. 38, NO. 2, JUNE 2019
Publisher : LPPMP Universitas Negeri Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (802.41 KB) | DOI: 10.21831/cp.v38i2.23345

Abstract

Science process skills are one of the indicators to know the level of achievement of physics teaching goals. This research examines the influence of guided inquiry models through virtual laboratories on students' science process skills. The research was a quasi-experiment conducted at the senior high school in Mataram, Lombok. The samples were class XI students, as many as 58 people divided into two sample groups: experimental and control groups. The guided inquiry model through the virtual laboratory was applied to the experimental group and the conventional model for the control group. The instrument used was a performance sheet. A t-test was used to analyze the effect of learning model on science process skill. The results of this study found that the achievement of science process skills for the experimental group was higher than the control group. The guided inquiry models through virtual laboratory have a significant effect on science process skills, especially on skills: hypothesizing, practicing, and communicating. These findings contribute significantly to the current knowledge about the effectiveness of guided inquiry models through virtual laboratories to improve students' science process skills in physics teaching.
PENGGUNAAN KOMPOS TANDAN KOSONG KELAPA SAWIT SEBAGAI SUBTITUSI PUPUK NPK DALAM PEMBIBITAN AWAL KELAPA SAWIT Agung, Andi Kurnia; Adiprasetyo, Teguh Adiprasetyo; Hermansyah, Hermansyah
Jurnal Ilmu-Ilmu Pertanian Indonesia Vol 21, No 2 (2019)
Publisher : Program Studi Ilmu Tanah Fakultas Pertanian UNIB

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.31186/jipi.21.2.75-81

Abstract

[THE USE OF OIL PALM EMPTY-FRUIT-BUNCHES COMPOST AS THE SUBTITUTE FOR NPK FERTILIZER IN THE OIL PALM PRE-NURSERY]. Compost of oil palm empty fruit bunches (OPEFB) is rich in nutriets needed to support the plant growth and offers as the substitute for chemical fertilizers. The purpose of this study was to determine the rates OPEFB compost and NPK fertilizer applications on the best suited for the growth of oil palm seedlings during pre-nursery. The OPEFB compost at 50, 100, and 150 g/pot was applied in factorial combination with with NPK at 0.0, 2.5, and 5.0 g/pot. Data were collected for seedling height, stem diameter, leaf number and leaves greenness. Higher leaf number was observed when OPEFB compost applied at 100 or 150 g/plot with or without additional NPK. Seedling height, stem diameter, and leaves greenness were increased with the application of OPEFB compost at 50 g/pot but no further increase with the additional rates. Additional application of NPK only increased the leaf greenness.
AL-ISLāM WA AL-THAQāFAH AL-MAHLīYAH: DIRāSAH Fī MUJTAMA’ “EMBAU” Fī KAPUAS HULU KāLIMANTāN AL-GHARBīYAH Hermansyah, Hermansyah
Studia Islamika Vol 15, No 1 (2008): Studia Islamika
Publisher : Center for Study of Islam and Society (PPIM) Syarif Hidayatullah State Islamic University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (7299.46 KB) | DOI: 10.15408/sdi.v15i1.539

Abstract

The research for this piece was carried out in Embau - one of the sub districts of the region of Kapuas Hulu. Socio - demo graphically, this region is inhabited by n community of Muslims that that continues to grow in numbers. Further to the Muslims, the area is inhabited by considerable numbers of non-Muslim Dayaks and other migrants to the area. What is interesting to note is the process of Islamization of the Dayak community, which has occurred naturally as a result of its intersection with the Muslim community. It was the Malays, who appeared in the area hundreds of years ago, who brought Islam to the area. The introduction of Islam to the area has brought with it a number of changes to the Dayak community in West Kalimantan. Not only did many Dayaks adopt Islam as their religion, they further adopted the culture typical of other Muslims.DOI: 10.15408/sdi.v15i1.539
Co-Authors Adamy, Aulina Adiprasetyo, Teguh Adiprasetyo Agung Mataram Agung, Andi Kurnia Agussabti Agussabti Ahmad Fatoni Ahmad Harjono Aldes Lesbani Aminoto, Toto Andi Alimuddin Unde, Andi Alimuddin Angga Saputra Aras, Irianto Arifin, Zulkifli Arini, Feggy Aryza, Solly Aryza, Solly Ashar Saputra Asnawi Abdullah Aswadi Jaya, Aswadi Asyeni Miftahul Jannah Aylia, Lely Barchia, Faiz Bayu Adhi Tama Busori Sunaryo Chozin, M. Chozin, M. Cici Handayani, Cici Ciptayasa, I Nyoman Dahlanuddin Dahlanuddin, Dahlanuddin Dedik Budianta Devras, Eri Dewi Wulandari Dhini, Debby R Djungdjunan Ardy, Djungdjunan Dwi Haryono Dwiyani, Nurindah Eddy Purnomo Efrizal Efrizal Elisma Elisma Enita, Enita Eti Kurniati, Eti Evi Rosmiyati, Evi Evizariza Evizariza, Evizariza Fachrijal, Fachrijal Fachry, Anwar Fadillah, Fitriani Fatma Fatma Fatmala, Noni Fauziyah Fauziyah Febrianto, Azis Firlianty, Firlianty Firman Firman Firmansyah, Dafit Fitriyanto, Syarif Gaol, Elsa Rama Lumban Genji, Bambang Gulo, Temazisokhi Gunawan Gunawan Gunawan, Purnawan Gustomi, Leo Fajar Harian Saputra, Harian Harun, Fitria Hasanudin Hasanudin Hasbun Kosim, Hasbun Heni Yohandini Herliyanto Herliyanto, Herliyanto Herpratiwi Herpratiw Herpratiwi Herpratiwi Hidayat, Kgs Agus Taufik Hilda Zulkifli Indah, Susi Puspita Isah Aisyah, Isah Ismail Marzuki Ismail, Nizam Jamaludin Jamaludin Juli Yani, Juli Junaidi Junaidi Juswandi Juswandi, Juswandi Kasim Kasim Kasmiarti, Getari Kriswanto, Joko Suyono Lina, Ratu Karel Lovy Herayanti Marlin, Marlin Marwanto Marwanto, Marwanto Maulin Wiraningsih, Maulin Mayasari Mayasari, Mayasari Mediana, Meta Merakati Handajaningsih Mgs. Irsan Saleh, Mgs. Irsan MIKSUSANTI MIKSUSANTI Mochamad Ashari Mohd. Fauzi, Mohd. Muhammad Kasim Muhammad Yasin Munazar, Munazar Muthia, Putri Muthia, Putri Nabela, Danvil Nirwan Syarif, Nirwan Norhafani, Norhafani Novia Novia Nuansa Bayu Segara Nugroho, Muhammad Prasetyo Nurhasana, Eky Arjayanto Nurhayati Nurhayati Panagan, Almunadi T Pareek, Vishnu K Pariyana, Pariyana Pauline, Rini Siti Perdana, Nova Permadi, Andi Gilang Poedji Loekitowati H, Poedji Poedji Loekitowati Hariani Prasetyo Prasetyo Prayitno, Slamet Rachmat Hidayat Rahmadian, Rizki Rani Rahmayani, Rani Rasyad Rasyad, Rasyad Reagan, Muhammad Ridwan Mahanka, Ridwan Ridwan3, Iwan M Risfidian Mohadi Rismayeti Rismayeti, Rismayeti Rodiyatul F. S. Rusli Yusuf Saleh, Busri Salmayati, Salmayati Samosir, Windarina Santoso, Herlina Saputra, Irwan Siahaan, Andysyah Putera Utama Siahaan, Andysyah Putera Utama Simanihuruk, Bilman Wilman Siswanto, Muhammad Fauzie Soedibyo Soedibyo Soekardono Soekardono, Soekardono Soemardiawan, Soemardiawan Sofia Sandi Sri Hartati Subakti, Subakti Subriyer Nasir Suhatri Suhatri Suherman Suherman Suhubdy Suhubdy Sulistyarini Sulistyarini, Sulistyarini Sumardi Sumardi Supanjani, Supanjani supriadin supriadin Surya Darma Surya Darmawan, Ede Suryaningsih, Oyi Febri Susi Susanti Susila Arita Susilawati Susilawati Sutami, Novian Sutaryono, Yusuf Ahyar Syamsul Hidayat Dilaga, Syamsul Hidayat Tahlil, Teuku Tamsil, Hasil Teguh Budi Prasetyo Tengku Muhammad Sum, Tengku Muhammad Tjekyan, Suryadi Toekidjo Martoredjo, Toekidjo Tri Sunardi, Tri Tri Utami Waruwu, Filsafat Wijaya, Ernani Winandy, Rian Jatmiko Yahya, Fahmi Yasin, Muhamad Yoyon Efendi, Yoyon Yulistia, Eriyana Yusri, Iin Karmila Zazili Hanafiah Zebua, Fynnisa Zulkarnain Lubis, Zulkarnain Zulkhairi Zulkhairi, Zulkhairi