Eka Julianti
Program Studi Pendidikan Biologi FKIP Untan

Published : 3 Documents

Found 3 Documents

Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.2.2.2012.1043


ABSTRAK Penelitian ini bertujuan untuk mempelajari morfologi daluga di Kepulauan Sangihe dan korelasinya dengan kondisi iklim setempat. Penelitian ini dilakukan di tiga lokasi yang berbeda, yaitu Tamako, Manganitu Selatan dan Tatoareng. Hasil penelitian menunjukkan bahwa daluga tumbuh pada ketinggian 3-24 m di atas permukaan laut dengan suhu udara 26 ? 38 oC, suhu air 25 ? 30 oC, kelembaban relatif 33 ? 70 %, pH 5-7 dan salinitas 5-10 ppm. Morfologi daluga berbeda di ketiga lokasi pengamatan. Perbedaan yang dimaksud mencakup panjang dan berat helaian daun, panjang tulang daun utama, basal kiri dan kanan, tebal tulang daun bagian pangkal, jarak tulang daun lateral dan lebar celah daun, panjang dan diameter tangkai daun, jumlah duri, lebar spatha, diameter spadix, panjang bunga betina, bunga jantan dan bunga mandul, serta diameter dan berat kormus. Suhu udara dan air berkorelasi negatif dengan diameter kormus, tetapi kelembaban berkorelasi positif dengan diameter kormus. pH berkorelasi negatif dengan berat helaian daun, salinitas berkorelasi negatif dengan lebar spatha, tetapi elevasi berkorelasi positif dengan lebar spatha. Kata kunci: daluga, kondisi iklim, morfologi ABSTRACT This research aimed to study daluga morphology in Sangihe Archipelago and the correlation of morphology and climate conditions. The research was conducted in  three different locations, i.e. Tamako, South Manganitu and Tatoareng. The result showed that daluga grew at 3 ? 24 m above the sea level with the air temperature 26 ? 38 oC, water temperature 25 ? 30 oC, relative humidity 33 ? 70 %, pH 5-7 and salinity 5 ? 10 ppm. There are some morphological differences of daluga in Tamako district, South Manganitu and Tatoareng. These differences  included the length and weight of leaf blade, the length of the main leaf blade, left and right basal, the thickness of base blade, the distance between lateral blade and leaf sinus denuding, the length and diameter of petiole, number of spines, spatha width, spadix diameter, flowers length, diameter and weight of cormus. The temperature of air and water were negatively correlated with diameter cormus, but the humidity was positively correlated with the cormus diameter. pH was negatively correlated with the weight of leaf blade, the salinity was negatively correlated with the spatha width, but the elevation was positively correlated with the spatha width. Keywords: daluga, climate condition, morphology
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10547


Abstrak  Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5?CGTACAGTACTTTTGTGTTTACGAG 3?) dan matK-1R-f (5?ACC CAGTCCATCTGGAAATCTTGGTTC3?). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp. Abstract  Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not  distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.
Cakradonya Dental Journal Vol 10, No 2 (2018): Agustus 2018
Publisher : FKG Unsyiah

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (304.378 KB) | DOI: 10.24815/cdj.v10i2.11713


Penutupan fisura merupakan metode pencegahan non-invasif yang efektif pada permukaaan gigi dengan pit dan fisura yang dalam dan sempit untuk mencegah terjadinya karies. Bahan penutupan fisura yang sering digunakan adalah resin komposit dan Glass Ionomer Cement (GIC). Penelitian ini bertujuan untuk mendapatkan informasi tentang perbandingan tingkat kebocoran mikro antara resin komposit dan GIC sebagai bahan penutupan fisura melalui evaluasi in vitro setelah satu bulan aplikasi. Spesimen penelitian berjumlah 16 gigi premolar rahang atas dengan pit dan fisura yang dalam dan sempit. Spesimen ini dikelompokkan menjadi 2 kelompok perlakuan. Kelompok pertama menggunakan resin komposit (3M ESPE Clinpro) dan kelompok kedua menggunakan GIC (Fuji VII). Spesimen dilakukan pengkondisian selama satu bulan didalam inkubator dan direndam dalam larutan methilene blue 5% selama 24 jam. Spesimen kemudian diamati dengan menggunakan stereo mikroskop dan diukur tingkat kebocorannya. Skor kebocoran mikro menggunakan penetrasi dye dengan tiga kriteria skor yaitu 0, 1, dan 2. Data dianalisis menggunakan statistik nonparametrik (uji Mann Whitney). Hasil analisis menunjukkan terdapat perbedaan skor kebocoran mikro yang signifikan antara bahan penutupan fisura resin komposit dan GIC (p<0,05). Kelompok penutupan fisura dengan resin komposit memiliki rerata skor kebocoran mikro lebih kecil (0,25) dibandingkan kelompok penutupan fisura dengan GIC (1,875) setelah penutupan fisura satu bulan.