Articles

Found 29 Documents
Search

STUDI AWAL DEPOSISI LAPISAN TIPIS YTTRIA-STABILIZED ZIRCONIA (YSZ) PADA SUBSTRAT BAJA FERITIK DENGAN METODE PLD - PULSED LASER DEPOSITION Agusutrisno, Agusutrisno; Suharyadi, Edi; Mardiyanto, Mardiyanto; Rivai, Abu Khalid
Jurnal Spektra Vol 16, No 1 (2015): Spektra: Jurnal Fisika dan Aplikasinya
Publisher : Jurnal Spektra

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

AbstrakStudi awal lapisan tipis Yttria-Stabilized Zirconia (YSZ) telah berhasil dideposisi di atas substrat baja feritik dengan teknik Pulsed Laser Deposition (PLD) di fasilitas laboratorium Pusat Sains dan Teknologi Bahan Maju - BATAN. Lapisan tipis ini dideposisi dengan tekanan chamber dalam rentang 200 mTorr hingga 225 mTorr dengan temperatur substrat pada temperatur ruang serta pulsa tembakan laser adalah 30×1000 tembakan dengan frekuensi 10 Hz. Selanjutnya sampel yang diperoleh dianalisis dengan Optical Microscope (OM), X-Ray Diffractometer (XRD), Raman Spectrometer dan Atomic Force Microscope (AFM). Sebagai bahan perbandingan sampel tersebut dipanaskan (annealing) pada temperatur 800oC kemudian dikarakterisasi dengan metode yang sama. Hasil analisis secara visual maupun dengan OM serta AFM menunjukkan bahwa lapisan YSZ telah terdeposisi di atas permukaan substrat baik sebelum dipanaskan maupun setelah dipanaskan. Karakterisasi struktur kristal sampel menggunakan X-ray Diffraction (XRD) menunjukkan bahwa derajat kristalinitas lapisan tipis YSZ masih rendah baik dengan substrat dipanaskan maupun tanpa dipanaskan. Karakterisasi Raman Spectroscopy menunjukkan bahwa pada deposisi dengan temperatur ruang belum tampak dengan jelas ikatan dan fasa YSZ. Sedangkan pada sampel dengan substrat dipanaskan menghasilkan puncak pada 550 cm-1 yang menunjukkan bahwa lapisan cenderung amorf. Karakterisasi topografi permukaaan menggunakan AFM menunjukkan bahwa sampel yang dideposisi menggunakan teknik PLD menghasilkan surface roughness yang sangat halus dalam rentang nano-meter sehingga berpotensi digunakan sebagai aplikasi Thermal Barrier Coating (TBC) pada material temperatur tinggi.Kata kunci: Lapisan tipis, Yttria-Stabilized Zirconia (YSZ), Pulsed Laser deposition (PLD), baja, nano-meter AbstractPRELIMINARY STUDY OF A YTTRIA-STABILIZED ZIRCONIA (YSZ) THIN FILM DEPOSITION ON A FERRITIC STEEL SUBSTRATE USING PLD - PULSED LASER DEPOSITION METHOD. A thin film of Ytrria-Stabilized Zirconia has been deposited on a ferritic stainless steel by Pulsed Laser Deposition (PLD) at laboratory facilities of Center For Science and Technology of Advanced Materials-BATAN. The thin film was deposited with the chamber pressure range of 200 mTorr to 225 mTorr, substrate temperature at room temperature, and 30x1000 shots of pulsed-laser with 10 Hz of frequency. Afterward, the sample was analyzed using Optical Microscope (OM), X-Ray Diffractometer (XRD), Raman Spectrometer and Atomic Force Microscope (AFM). As for comparison analysis, the sample was annealed at 800oC then characterized using the same methods. The result of analyses with visually and using OM then AFM showed that the thin film of YSZ was deposited on the surface of the substrate. The characterization of the crystal structure of the sample by using XRD showed that the crystallinity degree of thin film with the substrate both with and without annealing was still low. Raman spectroscopy characterization showed that the bond and phase of YSZ deposition with the substrate at room temperature were not clearly formed. Whereas the sample was annealed resulted peak at 550 cm-1, which is showed that the thin film was still amorphous. Surface topography characterization using AFM showed that the surface roughness of the sample deposited by PLD method was relatively smooth in the range of nano-meter.Keywords: Thin film, Yttria-Stabilized Zirconia (YSZ), Pulsed Laser Deposition (PLD), steel, nano-me
STRUKTUR MIKRO BAHAN PIEZOELEKTRIK BEBAS TIMBAL TITANAT-BARIUM TITANAT KALIUM NATRIUM NIOBATE HASIL SINTESIS DENGAN METODE REAKSI PADAT Mardiyanto, Mardiyanto; Ahda, Syahfandi
Jurnal Sains Materi Indonesia Vol 13, No 2: FEBRUARI 2012
Publisher : Center for Science & Technology of Advanced Materials - National Nuclear Energy Agency

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17146/jsmi.2012.13.2.4716

Abstract

STRUKTUR MIKRO BAHAN PIEZOELEKTRIK BEBAS TIMBAL TITANAT-BARIUM TITANAT KALIUM NATRIUM NIOBATE HASIL SINTESIS DENGAN METODE REAKSI PADAT. Telah dilakukan sintesis bahan keramik piezoelektrik Timbal Titanat-Barium Titanat-Kalium Natrium Niobate (BNT-BT-KNN )ramah lingkungan yakni bahan yang tidak mengandung unsur timbal dan merupakan bahan campuran antara bahan keramik Bismuth Natrium Titanat (BNT), Barium Titanat (BT) dan Kalium Natrium Niobate (KNN). Pada penelitian ini telah dilakukan sintesis BNT-BT-KNN dengan metode reaksi padat. Setelah proses sintesis strukturmikro bahan dikarakterisasi menggunakan X-Ray Diffractometer (XRD) dan Scanning Electron Mocroscope (SEM). Bahan BNT-BT-KNN yang disintesis memiliki rumus kimia (0,94-y)BNT-0,06BT-y KNN dengan harga y divariasikan dalam persentase mol sebesar 3 %, 6 % dan 8 %. Bahan campuran dipelet dengan tekanan sebesar 3500 psi dan di sinter pada suhu 1000 oC selama 4 jam. Bentuk pola difraksi BNT-BT-KNN yang terbentuk sama dengan bentuk pola difraksi yang di lakukan oleh peneliti sebelumnya. Dari pola difraksi bahan BNT-BT-KNN yang terbentuk mempunyai struktur kristal tetragonal dan terjadi pergeseran puncak sehingga mengidentifikasikan bahwa terjadi perubahan struktur tetragonal ke struktur rombohedral. Dari hasil SEM terlihat bahwa dengan kenaikan penambahan KNN terlihat bahan semakin berongga dengan ukuran yang semakin kecil dan lebih merata.
Rancang Bangun Sistem Informasi Pengawasan Pelaksanaan Pekerjaan Studi Kasus PT. PLN Area Surabaya Utara Mardiyanto, Mardiyanto; Pattiasina, Timothy John; Setyoadi, Eddy Triswanto
Teknika Vol 5 No 1 (2016): November 2016
Publisher : Pusat Penelitian dan Pengabdian Kepada Masyarakat, Institut Informatika Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1781.748 KB)

Abstract

Sistem informasi berbasis komputerisasi merupakan salah satu faktor penting bagi perusahaan dalam mengelola segala aktifitasnya. Dalam hal ini, penerapan sistem informasi khususnya dalam pengawasan pekerjaan atau Surat Perintah Kerja (SPK) di perusahaan yang bergerak dalam pengelolaan proyek pekerjaan yang bekerjasama dengan pihak ketiga yang disebut juga dengan vendor atau mitra kerja masih sangat minim. Sistem Informasi Pengawasan Pelaksanaan Pekerjaan di PT PLN Area Surabaya Utara adalah suatu sistem yang dapat mengelola pendistribusian informasi pelaksanaan pekerjaan dan mampu menginformasikan status dari pelaksanaan pekerjaan tersebut. Sistem ini dibangun untuk mempermudah manajemen dalam mengelola pengawasan pelaksanaan pekerjaan atau Surat Perintah Kerja yang ada pada perusahaan. Selain itu sistem ini mampu memberikan notifikasi serta pengingat terhadap deadline pekerjaan melalui aplikasi berbasis XMPP yaitu Cangkruk yang sudah diterapkan di PT PLN Area Surabaya Utara.
Pengembangan Metode Identifikasi Dna (Pij702) Menggunakan Prinsip Lisis Alkali dan Pengendapan dengan Natrium Asetat pH 2 Untari, Budi; Mardiyanto, Mardiyanto
Jurnal Penelitian Sains No 14 (2003)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Telah dilakukan perbaikan visualisasi plasmid bermarka melanin (pIJ 702) pada Streptomyces lividans Rekombinan dengan modifikasi metode lisis alkali. Larutan netrium asetat yang digunakan untuk mengendapkan DNA dalam metode lisis alkali didapat pada pH 2 memberikan hasil yang terbaik dalam menvisualisasikan pita plasmid pIJ 702. Dengan perendaman etidium bromida (50 mg dalam 50 mL air) lebih dari waktu normal juga tidak memperlihatkan melanin pengganggu, sedangkan larutan buffer penyimpan yang di dapat pada pH di bawah 7 tidak memberikan pengaruh yang berarti (p = 0,05). Hasil visualisasi fragmen Bam H1 plasmid pIJ 702 juga jelas pertanda metoda bebas dari pengaruh melanin. 
Rancangan Primer Untuk Aplikasi Gen Pengkode Kitinase dari Bacillus Substillis Mardiyanto, Mardiyanto; Yusuf, Setiawan
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Telah dilakukan penelitian tentang perancangan primer untuk aplifikasi gen pengkode kitinase dari Bacillus substillis. Hasil perancangan dan amplifikasi akan dipergunakan untuk proses overproduksi kitinase yang akan dimanfaatkan pada bidang kesehatan dan pertanian. Dari proses perancangan diketahui bahwa gen pengkode kitinase dari Bacillus substillus ditemudi cds tidak dimulai dari basa pertama dan ada 186 basa dihitung dari strat kodon, primer yang dihasilkan tidak memperlihatkan empat basa yang berurutan menempel pada kondisi self dimmer ataupun hair pin loop. Urutan primer yang siperoleh adalah Forward aaaagggggtgaacaaaatagagt dan Revearese acacggtcgtcgtcagcaagta
Isolasi Sekreted Amylase dari Streptomyces Lividans yang Ditumbuhkan pada Media Minim Protein Yusuf, Setiawati; Mardiyanto, Mardiyanto
Jurnal Penelitian Sains No 13 (2003)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Telah dilakukan isolasi sekreted amylase dari Streptomyces lividans yang ditumbuhkan dalam media yang minim protein. Pola fragmentasi protein sekreted amylase hasil fraksinasi 50% ammonium sulfat diuji dengan SDS-PAGE (Sodium Dodecyl Sulphate-Poly Acrylamide Gel Electrophoresos) sedangkan pemisahan serta deteksi sekreted amylase dilakukan dengan metode antibody traped. Sekreted amylase dengan konsentrasi 50 ng/ml terdeteksi oleh antibodi sedangkan konsentrasi 120 ng/ml memperlihatkan noda optimal.
Optimasi Formula Submikro Partikel Poly (Lactic-co-Glycolic Acid) Pembawa Betametason Valerat dengan Variasi Konsentrasi Poly (Vinyl Alcohol) dan Waktu Sonikasi Mardiyanto, Mardiyanto; Fithri, Najma Anuria; Raefty, Winesfin
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 1 (2018): J Sains Farm Klin 5(1), April 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.5.1.55-65.2018

Abstract

Preparation of betamethasone valerate (BMV) into submicro particle aims to resolve the solubility problem (Biopharmaceutics Classification System II) and to increase penetration through the skin. The method of emulsion solvent evaporation is used in preparing BMV encapsulated by PLGA (Poly (Lactic-co-Glycolic Acid) as polymer and PVA Poly (Vinyl Alcohol) as stabilizer. The proportion of optimum formula components obtained were 50 mg PVA and 10 minutes sonication time with the response values which resulted %EE of 73.000%, pH of 4.800, and %weight of BMV on stability test of 62.057%.The resulting diameter, PDI (poly dispersity ndex), and zeta potential analysis of the optimum formula were 342.700 nm, 0.104, and -12.200 mV respectively. Result from the particle morphology using Transmission Electron Microscopy showed spheric shape particle. The diffusion test showed the highest diffusion percent value on submicro particles of PLGA-BMV (23.067% ± 0.055) compared with pure BMV (18.007% ± 0.002) and comercial BMV cream (19.506%± 0,071). Analysis of the dissolution rate showed that submicro particles of PLGA-BMV (84.211% ± 1.943) increased the amount of drug released compared to pure BMV (10.912% ± 0.246). The release rate and mechanism of PLGA-BMV followed zero order.
Furosemide self nano emulsifying drug delivery system (SNEDDS) formulation comprising of capryol-90, polysorbate-80, and peg-400 with simplex-lattice-design Fithri, Najma Annuria; Mardiyanto, Mardiyanto; Novita, Rennie Puspa; Andrean, Vicky
Science and Technology Indonesia Vol 2 No 4 (2017): October
Publisher : ARTS Publishing

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (371.588 KB) | DOI: 10.26554/sti.2017.2.4.85-88

Abstract

Preparation of SNEDDS aims to improve solubility and absorption of furosemide in the body to reduce the dosage and minimize the side effects of drugs. Ternary diagram constructed from composition mixture produced nanoemulsion in the range of 20-40% of capryol-90, 20-40% polysorbate-80 and 40-60% PEG-400. Formulations of SNEDDS using Design-Expert®10 with simplex-lattice-design method in the study was aimed to investigate the effect of SNEDDS each components proportions towards test responses. Emulsification time, drug content and viscosity were best demonstrated by run-7 with consecutive values of 131.68±2.14 seconds, 99.89±2.68% and 0.87±0.0043 mm2/s. The optimum formula was obtained through entering test response parameter data of all thirteen formula. Drug content and emulsification time was 107.0 ± 1.44% and 155.59±1.56 seconds with viscosity value 0.91±0.00 mm2/s. From the physical stability studies, SNEDDS formulas were stable and did not show phase separation when exposed to temparature stress testing.  
The Standardization of Ethanolic Extract of Tahongai Leaves (Kleinhovia hospita L.) Solihah, Indah; Mardiyanto, Mardiyanto; Fertilita, Soilia; Herlina, Herlina; Charmila, Oktia
Science and Technology Indonesia Vol 3 No 1 (2018): January
Publisher : ARTS Publishing

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (335.941 KB) | DOI: 10.26554/sti.2018.3.1.14-18

Abstract

Extract is basic material for herbal drug. The formulation of herbal drugs requires consistent of biological activity, a consistent chemical profile, or simply a quality assurance programs that can be achieved by standardizing extracts. The leaves of tahongai (Kleinhovia hospita L.) have been traditionally used in Komering tribes as phytotherapy to cure the inflammation related diseases including cancer, furuncles, polyps and tonsillitis. The aim at this study was to standardize the quality of tahongai leaves ethanolic extract by determining the specific and non specific parameters of ethanolic extract of Tahongai leaves (Kleinhovia hospita L.). The Preliminary phytochemical analysis revealed presence of alkaloids, flavonoids, saponins, tanins, and steroids in extract. The result of specific parameters extracts showed that the organoleptic properties of ethanolic extract of tahongai leaves were thick, brownish black in color, has characteristic odor, astringent with slightly bitter taste, the water and ethanol soluble extractive content were 19.263% ± 0.95 and 18.30% ± 0.51 respectively. The non specific parameters of tahongai leave ethanolic extract showed the density of extract was 1.413 g/mL ± 0.04, the water content value of 21.16% ± 0.55, total ash content 15.64% ± 0.75, acid insoluble ash content 8.282% ± 0.28, Pb contamination content 3,67 ppm, Cd contamination content <0,0043 ppm, total bacteria contamination 90.5 x 101 colony/g, and the total mold and yeast contamination of 1 x 101 colony/g.
DISCHARGE CHARACTERISTIC OFSILVER SOLID STATE BATTERY. Kartini, E.; Gunawan, Gunawan; Mardiyanto, Mardiyanto; Hindasyah, A.; Salam, R.
Jurnal Sains Materi Indonesia Vol 8, No 1: OKTOBER 2006
Publisher : Center for Science & Technology of Advanced Materials - National Nuclear Energy Agency

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.17146/jusami.2006.8.1.4810

Abstract

DISCHARGE CHARACTERISTIC OFSILVER SOLID STATE BATTERY. Asilver solid electrolyte based on superionic glass (AgI)x(AgPO3)1-x has been produced by melt-quenching method. The solid state batteries have been fabricated with the cell configuration: Anode//(AgI)x(AgPO3)1-x//Cathode. Ag-metal was used as an anode, and Iodine was used as a cathode. The solid state battery discharge characteristic has been carried out under two different load conditions, 20 k? and 50 k?. Cell parameters viz. current density, power density, discharge capacity and energy density were evaluated and reported. The power density of the solid state battery was approximately larger than 3.45 mWh.