Articles

AUTHENTICATION OF WILD BOAR MEAT IN MEATBALL FORMULATION USING DIFFERENTIAL SCANNING CALORIMETRY AND CHEMOMETRICS Guntarti, Any; Rohman, Abdul; Martono, Sudibyo; Yuswanto, Agustinus
Journal of Food and Pharmaceutical Sciences Vol 5, No 1 (2017): J. Food Pharm. Sci (January-April)
Publisher : Fakultas Farmasi, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (560.177 KB) | DOI: 10.14499/jfps

Abstract

Bakso or meatball is one of the Indonesian favorite foods, commonly made from beef. This food is quite popular among Indonesian societies. Due to the high price of beef, unethical producers may adulterate beef with wild boar meat (WBM). In this study, the potential use of differential scanning calorimetry (DSC) combined with multivariate calibration was used to verify adulteration of WBM in meatball formulation. Oil extracted from WBM is characterized by significantly different cooling and heating DSC thermal profiles. The change of characteristic exothermic and endothermic event in oil with increasing crystallization, melting enthalpy and developing both process over a narrower temperature range is investigated. In this research, we developed DSC and multivariate calibration of Partial Least Square (PLS) calibration to analyze WBM in beef meatball. Meanwhile, the chemometrics of Principle Componen Analysis (PCA) is used to classify WBM and beef in the meatball. The validation model using crystalization profiles yield the coefficient of determination (R2) of 0.999 for the correlation between actual value of WBM (x-axis) and DSC predicted value (y-axis) with equation of y= 0.9999 x + 0.0027, root mean square error of cross validation (RMSECV) of 0.380%, and root mean square error of prediction (RMSEP) of 0.203%. PCA is successfully used for classification of WBM in beef meatball. DSC in combination with PLS and PCA can be an alternative technique for analysis of WBM in meatball.Key words: Differential scanning calorimetry, Wild bear meat, Crystallization profile, Melting profile, Partial least square.
INHIBITION OF LIPID PEROXIDATION INDUCED BY ULTRAVIOLET RADIATION BY CRUDE PHLOROTANNIS ISOLATED FROM BROWN ALGAE SARGASSUM HYSTRIX V. BUXIFOLIUM C. AGARDH Harnita, Agnes Nora Iska; Santosa, Ign. Edi; Martono, Sudibyo; Sudarsono, Sudarsono; Widyarini, Sitarina; Harren, Frans J.M.
Indonesian Journal of Chemistry Vol 13, No 1 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.21320

Abstract

This study examines the antioxidant activity of crude phlorotannins from the brown algae Sargassum hystrix v. buxifolium (Chauvin) J. Agardh, through the inhibition of a lipid peroxidation reaction that is induced by the UV radiation. The antioxidant activity during the UV exposure was investigated using the laser-based photoacoustic method for the detection of the ethylene as indicator for lipid peroxidation. This involves an experiment that isolated crude phlorotannins from the ethyl acetate fraction of the Sargassum hystrix methanol extract, hereafter referred to as PFSH. It results in the antioxidant activity as a potent lipid peroxidation inhibitor. Statistically, such antioxidant activity is not significantly different than the commercial antioxidant, which is vitamin C (p > 0.05). The amount of the total phlorotannins, using the Folin-Ciocalteu method, was measured to be approximately 0.13% w/w. In addition, it is found that PFSH contains phlorotannins with low molecular weight (MW) (
EMPLOYING AN R SOFTWARE PACKAGE RSM FOR OPTIMIZING OF GENISTEIN, DAIDZEIN, AND GLYCITEIN SEPARATION AND ITS APPLICATION FOR SOY MILK ANALYSIS BY HPLC METHOD Riswanto, Florentinus Dika Octa; Desra, Alni; Sari, Rinjani Mustika; Thomas, Valentino; Rohman, Abdul; Pramono, Suwidjiyo; Martono, Sudibyo
Indonesian Journal of Chemistry ARTICLE IN PRESS
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/ijc.51669

Abstract

Soy milk, one of the soybean products, become more popular in recent years due to its benefit for human health. Biological activities of soybean products have been widely studied according to the presence of isoflavone aglycones content, including genistein, daidzein, and glycitein. Hence, it is important to develop an effective and efficient analytical method to provide guidance regarding appropriate isoflavone intake levels for soy milk. A reversed-phase high performance liquid chromatography (HPLC) method was developed and optimized in this study employed by R statistical software with the package of rsm. A C18 column was used for HPLC separation with the detection at 260 nm. Optimized condition for HPLC separation has been achieved with the mobile phase of methanol: water (63.26:36.74), a flow rate of 0.81 mL/min, and a column temperature of 45.31 °C. These conditions were applied in the HPLC system and successfully tested for the system suitability. Quantitative estimation was performed and resulted that the genistein, daidzein, and glycitein content in soy milk samples were 6.372, 6.273, and 2.853 µg/mL, respectively.
OPTIMASI FORMULASI SIRUP FRAKSI TIDAK LARUT ETIL ASETAT YANG MENGANDUNG ALKALOID DARI BUNGA KEMBANG SEPATU (Hibiscus rosa-sinensis L.) Murrukmihadi, Mimiek; Wahyuono, Subagus; Marchaban, Marchaban; Martono, Sudibyo
Majalah Obat Tradisional Vol 16, No 2 (2011)
Publisher : Faculty of Pharmacy, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (209.064 KB) | DOI: 10.14499/mot-TradMedJ16iss2pp101-108

Abstract

Fraksi tidak larut etilasetat yang mengandung alkaloid dari bunga kembang sepatu (Hibiscus rosa-sinensis L.) dengan kadar 0,6% b/v mempunyai aktivitas mukolitik yang setara dengan asetilsistein 0,1% berdasarkan kapasitas menurunkan viskositas mukus. Penggunaan bunga kembang sepatu sebagai obat batuk baru dilakukan secara tradisional. Oleh karena itu dibuat sediaan sirup fraksi tidak larut etilasetat yang mengandung alkaloid dari bunga kembang sepatu. Penelitian ini bertujuan untuk mengetahui formula optimum sirup fraksi etanolik yang mengandung alkaloid dari bunga kembang sepatu menggunakan metode Simplex Lattice Design. Fraksi tidak larut etilasetat yang mengandung alkaloid dari bunga kembang sepatu diperoleh dengan menggunakan Vacuum Liquid Chromatography (VLC). Metode Simplex Lattice Design digunakan untuk optimasi formula sirup fraksi tidak larut etilasetat yang mengandung alkaloid dari bunga kembang sepatu  dengan tujuh formula berdasarkan variasi jumlah gliserin, larutan sorbitol 70%, dan mucilago CMC-Na 0,5%. Sifat fisik sirup diuji untuk mendapatkan nilai respon total (R total) terbesar sebagai parameter formula optimum menggunakan metode Simplex Lattice Design  dengan  software Design Expert® versi 8.0.2. Sirup formula optimum diperoleh dengan proporsi gliserin sebesar 25,376%; larutan sorbitol 70% sebesar 51,985%; dan mucilago CMC-Na 0,5% sebesar 22,639%. Sirup formula optimum dibuat, kemudian diuji sifat fisik selama 4 minggu penyimpanan. Data yang diperoleh dari uji sifat fisik sirup dibandingkan dengan nilai prediksi dengan software Design Expert® versi 8.0.2. Stabilitas fisik sirup formula optimum minggu ke 0 dibandingkan terhadap stabilitas fisik  minggu ke 4 menggunakan uji-t berpasangan. Hasil menunjukkan bahwa sifat fisik formula optimum sirup fraksi tidak larut etilasetat yang mengandung alkaloid dari bunga kembang sepatu tidak berbeda signifikan dengan prediksi untuk kemudahan dituang dan tanggap rasa kecuali  viskositas dan derajat keasaman. Sirup fraksi etilasetat yang mengandung alkaloid  dari bunga kembang sepatu hasil optimasi kurang stabil selama empat minggu penyimpanan.
PENETAPAN KADAR ALKALOID DARI EKSTRAK ETANOLIK BUNGA KEMBANG SEPATU (Hibiscus rosa-sinensis L.) Murrukmihadi, Mimiek; Wahyuono, Subagus; Marchaban, Marchaban; Martono, Sudibyo
Majalah Obat Tradisional Vol 18, No 2 (2013)
Publisher : Faculty of Pharmacy, Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (650.015 KB) | DOI: 10.14499/mot-TradMedJ18iss2pp%p

Abstract

Bunga kembang sepatu (Hibiscus rosa-sinensis L.) secara tradisional digunakan sebagai peluruh dahak. Berdasarkan atas Bioassay Guided Fractionation, fraksi aktif berhasil dipisahkan dan alkaloid merupakan kandungan utama fraksi. Oleh karena itu alkaloid digunakan sebagai senyawa penanda (marker) ekstrak etanol Hibiscus rosa-sinensis L. Nilai viskositas digunakan sebagai model untuk aktivitas peluruh dahak, dengan asetil sistein sebagai kontrol positif. Selanjutnya penetapan kadar alkaloid dalam ekstrak etanol dilakukan secara KLT-Densitometri (n=5), kadar alkaloid dibandingkan dengan kurva baku dari alkaloid (marker) hasil isolasi (Y=12,1360X+2901,4474). Kadar alkaloid dalam ekstrak etanol kembang sepatu (Hibiscus rosa-sinensis L.) sebagai 2,35 ± 0,67 %. 
REAL-TIME PCR-BASED DETECTION OF BOVINE DNA BY SPECIFIC TARGETING ON CYTOCHROME-B Salamah, Nina; Erwanto, Yuny; Martono, Sudibyo; Rohman, Abdul
Pharmaciana Vol 9, No 2 (2019): Pharmaciana
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.12928/pharmaciana.v9i2.14070

Abstract

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.
Anti-Inflammatory Activity of Ethanol Extract of Cashew Stem Bark (Annacardium Occidentale L.) on Rat Paw Edema Induced by Carrageenan Harsini, Harsini; Sutardja, Iwa; Martono, Sudibyo; Sunarintyas, Siti; Sudarsono, Sudarsono
The Indonesian Journal of Dental Research Proceeding Book
Publisher : The Indonesian Journal of Dental Research

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (19.124 KB)

Abstract

Introduction: Cashew stem bark (Anacardium occidentale L.) was traditionally used to cure inflammation in the oral cavity. Phenolic substances such as phenol and anacardic acid that have anti-inflammatory effect was found in cashew stem bark. The aim of this study was to investigate the anti-inflammatory activity of the ethanol extract of cashew stem bark and indometazine as Non-steroid anti-inflammatory drug. Materials and Methods: Cashew stem bark was collected from Faculty of Dentistry, Universitas Gadjah Mada, Yogyakarta, Indonesia. Extraction was done by maceration method using ethanol as solvent. Anti-inflammatory activity of 40 mg/kg bw, 80mg/kg bw, 160mg/kg bw dosage of cashew stem bark extract was monitored and indometazine 10 mg/kg bw was used as positive control. Edema volume determination on rat paw was counted as area under cure (AUC) value and anti-inflammatory percentage. Result: This study result showed that total phenolic content on cashew stem bark was 12.25 ± 0.26% w/w gallic acid equivalent (GAE). The anti-inflammatory activity of cashew stem bark extract in this study were 9.985±6.483% for 40mg/kg BW, 15.576±6.754% for 80mg/kg bw, 25.87±19.7% for 160mg/kg bw and 56.85 ±15.52% for Indometazine 10 mg/kg bw. Analysis of Variance (ANOVA) method was applied on the results and showed significant anti-inflammatory activity of ethanol extract on cashew stem bark (p<0.05). Conclusion: In conclusion, ethanol extract of cashew stem bark has anti-inflammatory activity. However, its’ activity is lower than indometazine.
Activity of propyl p-benzoyloxybenzoate as mu-class glutathione s-transferase inhibitor Harnita, Agnes Nora Iska; Istyastono, Enade Perdana; Martono, Sudibyo
INDONESIAN JOURNAL OF PHARMACY Vol 17 No 2, 2006
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (173.279 KB) | DOI: 10.14499/indonesianjpharm0iss0pp76-80

Abstract

Non-steroidal anti-inflammatory drugs (NSAIDs) are the most prescribed medicines. Anti-inflammatory activity was reported to have relationship with the inhibition of prostaglandin synthesis, one of the inflammation mediators. The inhibition mechanism might be through the cyclooxygenase (COX) inhibition, oxygen radical scavenging, and mu-class glutathione S-transferase (GST) inhibition. Aspirin has been used as a NSAID since a hundred years ago and was reported as cyclooxigenase-1 (COX-1) selective inhibitor. The selectivity leds to gastrointestinal ulceration. Propyl p-benzoyloxybenzoate was a new compound which was predicted to have anti-inflammatory activity and would be developed to be an NSAID with minimum side effect.mu-class GST inhibition was examined using formation reaction model of GS-CNB conjugate through conjugation of 1,2-dichloro-4-nitrobenzene (DCNB) and glutathione (GSH) with GST (prepared from rat’s liver) as a catalyst. GSTs were isolated from the rat liver cytosolic fraction by centrifugation according to Lundgren. Protein concentration of the cytosol was determined spectrophotometrically by using bovine serum albumin as a standard. The GST activity was determined using conjugation reaction rate between DCNB and GSH, followed by determination of IC50 of propyl p-benzoyloxybenzoate. The result showed that propyl p-benzoyloxybenzoate has activity as  mu-class GST inhibitor with IC50 = 111.77 μM as the result from extrapolation.Key words: Anti-inflammatory, propyl p-benzoyloxybenzoate, inhibitor, mu-class glutathione S-transferase (GST).
Optimization of celery (Apium graveolens L.) herb extract granule production using Fluidized Bed Granulator Djatmiko, Mohammad; Soebagyo, Sri Sulihtyowati; Pramono, Suwijiyo; Martono, Sudibyo
INDONESIAN JOURNAL OF PHARMACY Vol 20 No 2, 2009
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.149 KB) | DOI: 10.14499/indonesianjpharm0iss0pp91-98

Abstract

Celery is an Indonesian herb being used as vegetable and medicinal purposes especially in hypotensive remedy. In order to produce a good quality of celery herb extract granules, a study on the influence of spray rate, level of lactose and Aerosil in fluidized bed granulator (FBG) toward homogeneity, flow rate and water content of granules was done.In the optimization process was programmed by factorial design, the maximum spray rate was 4 L/hours and the minimum was 2 L/hours, the maximum amount lactose was 100% and the minimum was 80% of extract weight, and Aerosil content maximal 20% and minimal 0% of extract weight. The optimum area of optimization result was found from superimposed contour plot granule parameters including homogeneity of apiin content, flow rate and moisture content of granules.The result showed that the Aerosil was proven to be disadvantageous in FBG process. The optimum area of optimization to obtain good granules was achieved by 2.75 L/hour to 2.00 1/hour of spray rate with the amount of lactose at 93.5% to 100% of extract weight with viscosity at 2.8 cP and density at 1.07 g/mL and without Aerosil. The granules possesed homogeneity of apiin with CV 3-5%, 0.85-1.00% of water content and 12.0-13.0 g/sec of flow rate.Key words: Celery (Apium graveolens L.), apiin, factorial design, extract, granules.
Analgesic and anti-inflammatory activities of combrang (Nicolaia speciosaHoran) stem the extract Susilowati, Sri Sutji; Martono, Sudibyo; Riyanto, Sugeng; Nugroho, Agung Endro
INDONESIAN JOURNAL OF PHARMACY Vol 22 No 2, 2011
Publisher : Faculty of Pharmacy Universitas Gadjah Mada, Yogyakarta, Skip Utara, 55281, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (184.077 KB) | DOI: 10.14499/indonesianjpharm0iss0pp115-119

Abstract

Long-term  goal  of  this  study  is  the  use  of  combrang  (Nicolaia  speciosa Horan)  as  an  ingredient  of  traditional  medicine  after  being  evaluated  through preclinical  testing  and  clinical  trials  both  extract  and  its  bioactive  compounds. This  study  includes  analgesic-antiinflammatory  activity  test  of  n-hexane, chloroform,  ethyl  acetate  and  methanol  extract  of combrang stem.  Analgesic test against crude extract of n-hexane, chloroform,ethyl acetate and methanol, using acetate writhing method. Antiinflammatory test using inhibition method of paw oedema by carrageenan induced on Wistar rats. Analgesic-antiinflammatory activity  compared  to  Na-diclofenac.  The  result  is  four  extracts  have  analgesic and  antiinflammatory  activity,  ethyl  acetate  extract  has  the  highest  analgesic and antiinflammatory activity.Key words: analgesics, anti-inflammatory, extract of combrang stem
Co-Authors . Sugiyanto Abdul Rohman Achmad Fudholi Agnes Nora Iska Harnita Agung Endro Nugroho Agus Siswanto Agustinus Yuswanto, Agustinus Akhmad Kharis Nugroho Andrih Rianti, Andrih Any Guntarti Arief Nurrochmad Arief Rahman Hakim Beti Pudyastuti, Beti Christine Patramurti, Christine Desra, Alni Dewi Setyaningsih Enade Perdana Istyastono Enade Pradana Istyastono, Enade Pradana Endang Lukitaningsih Fathul Jannah, Fathul Fitriyah Kusumawati, Fitriyah Florentinus Dika Octa Riswanto Frans J.M. Harren Gani, Andayana Puspitasari Harno Dwi Pranowo Harsini ,, Harsini Harsini Harsini, Harsini HINRICHS, WOUTER L.J. Ign. Edi Santosa Iqmal Tahir Iwa Sutardja, Iwa Iwa Sutardjo, Iwa Lukman Hakim Marchaban ., Marchaban Marchaban Marchaban, Marchaban Marchaban, . Marchaban, . Melania Perwitasari, Melania Mimiek Murrukmihadi Mohammad Djatmiko MUDJAHID, ROCHMAT Notario, Dion Nunung Yuniarti Nuvitasari, Reyna Pri Iswati Utami Ratna Asmah Susidarti Rohman, Abdul RR. Endang Lukitaningsih Salamah, Nina Sari, Rinjani Mustika Sitarina Widyarini Siti Sunarintyas Sri Sulihtyowati Soebagyo Sri Sutji Susilowati Subagus Wahyuono Sudarsono . SUDARSONO SUDARSONO Sudjadi Sudjadi Sugeng Riyanto Sugiyanto . Sugiyanto Sugiyanto Sumiyani, Ririn Sumiyani, Ririn Supardjan ., Supardjan Supardjan A. Margono, Supardjan Supardjan A.M., Supardjan Supardjan AM, Supardjan Suwidjiyo Pramono SUWIJIYO PRAMONO Thomas, Valentino Triana Hertiani Wiranti Sri Rahayu Yohanes Martono Yosi Bayu Murti Yuny Erwanto Zullies Ikawati