Articles

MICROENCAPSULATION OF PROBIOTICS AND ITS APPLICATIONS WITH PREBIOTIC IN PACIFIC WHITE SHRIMP LARVAE THROUGH ARTEMIA SP. Ramadhani, Dian Eka; Widanarni, Widanarni; Sukenda, Sukenda
Jurnal Akuakultur Indonesia Vol. 18 No. 2 (2019): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3603.271 KB) | DOI: 10.19027/jai.18.2.130-140

Abstract

ABSTRACTThis study aimed to produce microencapsulated probiotic Pseudoalteromonas piscicida (1Ub) and evaluate it with preb­iotic mannan-oligosaccharide (MOS) through the enrichment of Artemia sp., on bacterial population, growth performances, immune responses, and disease resistance of Pacific white shrimp larvae. Microencapsulation of probiotic was done by the freeze-drying method. The shrimp larvae were reared for 13 days and fed by the Artemia sp. enriched with microcapsule of probiotic 1Ub (10 g/L), prebiotic MOS (12 mg/L), synbiotic, and control without administration of microencapsulated probiotic and prebiotic, including negative (C-) and positive (C+) control. On the day 14, all of the experimental shrimp larvae except C- were challenged through immersion method with Vibrio harveyi MR5339 (107 CFU/mL). This study showed that the administration of microcapsule of probiotic 1Ub, prebiotic MOS, and synbiotic through the enrichment of Artemia sp. could increase the bacteria population, growth performances, immune responses, and disease resistance of Pacific white shrimp larvae. Moreover, synbiotic treatment demonstrated the best result compared to other treatments.Keywords: probiotic, prebiotic, synbiotic, Pacific white shrimp, microencapsulation ABSTRAKPenelitian ini bertujuan untuk membuat mikrokapsul probiotik Pseudoalteromonas piscicida (1Ub) dan mengevaluasinya dengan prebiotik mannan-oligosaccharides (MOS) melalui pengayaan Artemia sp. terhadap populasi bakteri, performa pertumbuhan, respons imun dan resistensi penyakit pada larva udang vaname. Mikroenkapsulasi probiotik dilakukan dengan metode freeze-drying. Larva udang dipelihara selama 13 hari dan diberi pakan Artemia sp. yang telah diperkaya dengan mikrokapsul probiotik 1Ub (10 g/L), prebiotik MOS (12 mg/L), sinbiotik, dan kontrol tanpa penambahan mikrokapsul probiotik dan prebiotik, termasuk kontrol negatif (C-) dan positif (C+). Pada hari ke-14, seluruh larva udang percobaan kecuali C- diuji tantang melalui metode perendaman dengan Vibrio harveyi MR5339 (107 CFU/mL). Hasil penelitian menunjukkan bahwa pemberian mikrokapsul probiotik 1Ub, prebiotik MOS, dan sinbiotik melalui pengayaan Artemia sp. dapat meningkatkan populasi bakteri, performa pertumbuhan, respons imun, dan resistensi penyakit pada larva udang vaname. Selain itu, perlakuan sinbiotik menunjukkan hasil terbaik dibandingkan perlakukan lainnya.Kata kunci : probiotik, prebiotik, sinbiotik, udang vaname, mikroenkapsulasi
SEAWEED EXTRACT OF GRACILARIA VERRUCOSA AS AN ANTIBACTERIAL AND TREATMENT AGAINST VIBRIO HARVEYI INFECTION OF LITOPENAEUS VANNAMEI Rudi, Mad; Sukenda, Sukenda; Wahjuningrum, Dinamella; Pasaribu, Wesly; Hidayatullah, Dendi
Jurnal Akuakultur Indonesia Vol. 18 No. 2 (2019): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3576.505 KB) | DOI: 10.19027/jai.18.2.11-20

Abstract

ABSTRACTThe objectives of this study were to investigate the antibacterial activity of G. verrucosa extract in test inhibitory zone with different concentrations (500, 1000, 1500, and 2000 mg/L) and  to examine G. verrucosa extract with different dosage (0.5, 1.0, 1.5, 2.0 g/kg) in feed on immune responses (total hemocytes count, phagocytic activity, phenoloxidase activity, respiratory burst) and survival rate in the Litopenaeus vannamei against the pathogenic Vibrio harveyi. Pacific white shrimp with an initial body weight of 5.25±0.55 g was reared in the aquarium (60×30×30 cm3) with a density of 10 shrimp/aquarium. Pacific white shrimp had been fed three times a day as much as 3% in at satiation for 14 days after challenged with V. harveyi. The first results of the inhibitory test showed that all the concentration of G. verrucosa extract was able to inhibit the growth of V. harveyi and the second result showed that the extract of G. verrucosa can increase the immune responses of shrimp. In the result of survival showed that shrimp fed with 0.5, 1.0, 1.5, and 2.0 g/kg has 80, 73, 70, and 70%, respectively. In conclusion, the seaweed extract of G. verrucosa has antibacterial activity and can induce the immune responses and resistance of Pacific white shrimp against V. harveyi infection.Keywords: Gracilaria verrucosa, seaweed, Vibrio harveyi, vibriosis,  Litopenaeus vannamei ABSTRAKTujuan dari penelitian ini adalah untuk menguji aktivitas antibakteri ekstrak G. verrucosa dalam uji zona hambat dengan konsentrasi yang berbeda (yaitu 500, 1000, 1500, dan 2000 mg/L) dan studi perlakuan pengobatan untuk menguji ekstrak G. verrucosa pada pakan dengan dosis yang berbeda (yaitu 0,5; 1,0; 1,5; dan 2,0 g/kg) pada respons imun (yaitu jumlah total hemosit, aktivitas fagositik, aktivitas fenoloksidase, respiratory burst) dan tingkat kelangsungan hidup pada udang vaname terhadap bakteri patogen Vibrio harveyi. Udang vaname dengan berat badan awal 5,25 ± 0,55 g dipelihara di akuarium (60 × 30 × 30 cm3) dengan kepadatan 10 udang/akuarium. Udang vaname  pasifik diberi makan tiga kali sehari 3% at satiation selama 14 hari setelah di uji tantang V. harveyi. Hasil pertama dari uji zona hambat menunjukkan bahwa semua konsentrasi ekstrak G. verrucosa mampu menghambat pertumbuhan V. harveyi dan hasil kedua menunjukkan bahwa pemberian ektrak G. verrucosa dapat meningkatkan respon imun udang. Hasil tingkat kelangsungan hidup menunjukkan bahwa perlakuan pakan udang dengan dosis 0,5; 1,0; 1,5; dan 2,0 g/kg memiliki tingkat kelangsungan hidup masing-masing 80, 73, 70, dan 70%. Kesimpulannya, ekstrak rumput laut G. verrucosa memiliki aktivitas antibakteri dan dapat menginduksi respons imun & ketahanan udang terhadap infeksi V. harveyi.Kata kunci: Gracilaria verrucosa, rumput laut, Vibrio harveyi, vibriosis, udang vaname 
THE USE OF IMMUNOSTIMULANT FROM PHYCOCYANIN OF SPIRULINA PLATENSIS TO CONTROL MOTILE AEROMONAD SEPTICAEMIA (MAS) DISEASE IN COMMON CARP CYPRINUS CARPIO Muchtar, Muthahharah; Sukenda, Sukenda; Nuryati, Sri; Hidayatullah, Dendi
Jurnal Akuakultur Indonesia Vol. 18 No. 1 (2019): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3473.183 KB) | DOI: 10.19027/jai.18.1.101-109

Abstract

                                                                  ABSTRAK         Motile aeromonad septicaemia (MAS) adalah penyakit yang sering menyerang ikan mas Cyprinus carpio yang disebabkan oleh bakteri Aeromonas hydrophila. Penelitian ini bertujuan untuk menguji kinerja imunostimulan fikosianin dari Spirulina platensis dalam mengatasi penyakit MAS pada ikan mas. Penelitian ini terdiri atas dua tahap, pertama, pakan ikan dengan penambahan fikosianin 150 mg/kg, 250 mg/kg, dan 350 mg/kg pakan serta kontrol tanpa penambahan fikosianin. Setelah 14 hari, ikan diuji tantang dengan A.hydrophila. Tahap kedua, dosis terbaik dari penelitian pertama digunakan untuk pakan ikan masing-masing selama satu minggu/bulan, dua minggu/bulan, tiga minggu/bulan, dan dua minggu/bulan dengan interval satu minggu. Setelah 28 hari, ikan diuji tantang dengan A. hydrophila. Hasil penelitian pertama menunjukkan bahwa kelangsungan hidup relatif (RPS) ikan yang diberi pakan fikosianin 150 mg/kg, 250 mg/kg, dan 350 mg/kg pakan adalah 87,50%; 81,25%; dan 75,00%. Total eritrosit, hemoglobin, total leukosit, aktivitas fagositik, dan respiratory burst menunjukkan hasil yang lebih tinggi daripada kontrol untuk semua perlakuan pemberian fikosianin. Penelitian kedua menunjukkan bahwa nilai RPS ikan diberi pakan selama satu minggu/bulan, dua minggu/bulan, tiga minggu/bulan, dan dua minggu/bulan dengan interval satu minggu yaitu 65,38%; 69,23%; 76,92%; dan 69,23%. Respons imun ikan yang diberi fikosianin lebih tinggi daripada kontrol serta mampu menekan jumlah bakteri A. hydrophila di hati, ginjal, dan usus. Kesimpulan dari penelitian ini bahwa pemberian fikosianin sebanyak 150 mg/kg pakan selama tiga minggu/bulan memiliki nilai RPS tertinggi. Kata kunci: fikosianin, Spirulina platensis, Aeromonas hydrophila, Cyprinus carpio  ABSTRACT Motile aeromonad septicaemia (MAS) is a major disease in common carp Cyprinus carpio caused by Aeromonas hydrophila. This study aimed to evaluate the performance of phycocyanin imunostimulant extracted from Spirulina platensis to control MAS disease in common carp. This study was conducted into two phases. First phase was conducted by adding 150 mg/kg, 250 mg/kg, 350 mg/kg feed phycocyanin dose, and 0 mg/kg feed phycocyanin dose as control treatment. Fish was challenged with pathogenic A.hydrophila after 14 days rearing. Second phase was conducted by applying the best dose obtained from the first phase added in the feed for feeding the fish in one week/month, two weeks/month, three weeks /month, and two weeks/month with one week interval. Fish was challenged with pathogenic A.hydrophila after 28 days rearing. First phase study result showed that the relative percent survival (RPS) for fish fed 150 mg/kg, 250 mg/kg, and 350 mg/kg phycocyanin dose were 87.50%, 81.25%, and 75.00% respectively. Total erythrocytes, hemoglobin, total leucocytes, phagocytic activity, and respiratory burst showed higher results than control treatment on all treated fish. The second phase study showed that fish fed one week/month, two weeks/month, three weeks/month, and two weeks/month with one week interval had RPS value 65.38%, 69.23%, 76.92%, and 69.23% respectively. The immune responses of treated fish were higher than control treatment, as well as the number of pathogenic A. hydrophila in the liver, kidney, and intestine. Fish fed with phycoyanin dose 150 mg/kg feed and three weeks/month administration had the highest RPS value. Keywords: Phycocyanin, Spirulina platensis, Aeromonas hydrophila, Cyprinus carpio 
BAKTERI PROBIOTIK DALAM BUDIDAYA UDANG: SELEKSI, MEKANISME AKSI, KARAKTERISASI, DAN APLIKASINYA SEBAGAI AGEN BIOKONTROL Widanarni, Widanarni; Sukenda, Sukenda; Setiawati, Mia
Jurnal Ilmu Pertanian Indonesia Vol. 13 No. 2 (2008): Jurnal Ilmu Pertanian Indonesia
Publisher : Institut Pertanian Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (348.509 KB)

Abstract

Bacterial disease attack occurs at the hatchery stage, which is considered to be the most serious threat, and often results in mass mortality of shrimp larvae by vibrosis which is that caused by a luminous bacterium identified as Vibrio harveyi. This research was carried out to obtain local isolates of probiotic bacteria that were able to inhibit the growth of V. harveyi and effectively apply it as a biocontrol of vibriosis in shrimp cultures. The research was carried out as follows: (1) In vitro and in vivo selection of probiotic bacteria candidates, (2) Study of the action mechanism and characterization of the selected pro biotic bacteria, (3) Study on application of the selected probiotic bacteria as a biocontrol agent in shrimp cultures. Results of in vitro and in vivo selection provided the best three isolates, which were 1Ub, SKT-b and Ua. The survival rate of shrimp larvae which were not only inoculated by V. harveyi but also with 1Ub, SKT-b and Ua probiotic bacteria were 88.33, 83.33, and 81.67% respectively; where as the positive control treatment (merely inoculated with V. harveyi) gave a 41.67% survival rate and the negative control (without bacterial addition) was 68.33%. Studies using a rifampicin resistant marker (RfR) demonstrated that the number of V. harveyi MR5339 RfR cells in treatments without probiotic addition were higher than the treatment with the probiotic bacteria, in dead larvae, living larvae, as well as in the culture media. Partial sequencing of the I6S-rRNA gene showed that the I Ub isolate was similar to Pseudoalteromonas piscicida, whereas the SKT -b and Ua isolates were similar to Vibrio alginolyticus. Selected probiotic bacteria could be applied directly to shrimp larva culture media, or orally through enrichment of both natural and artificial food. Keywords: Penaeus monodon larvae, probiotic bacteria, vibriosis 
EXTRACT OF SEAWEED GRACILARIA VERRUCOSA AS IMMUNOSTIMULANT TO CONTROLLING WHITE SPOT DISEASE IN PACIFIC WHITE SHRIMP LITOPENAEUS VANNAMEI Zahra, Aminatul; Sukenda, Sukenda; Wahjuningrum, Dinamella
Jurnal Akuakultur Indonesia Vol. 16 No. 2 (2017): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3350.961 KB) | DOI: 10.19027/jai.16.2.174-183

Abstract

ABSTRACT This experiment was conducted to examine effect of Gracilaria verrucosa extract in diet with different dosages to enhance immune response and resistance against white spot syndrome virus (WSSV) in the Pacific white shrimp. The experiment consisted of six treatments in three replicates respectively, namely K- (without extract), K + (without extract + infected WSSV), A (2 g/kg of feed + infected WSSV), B (3 g/kg of feed + infected WSSV), C (4 g/kg of feed + infected WSSV), and D (5 g/kg of feed + infected WSSV). White shrimp with initial body weight of 6.07±0.10 g were reared in the (60×30×30) cm with density of 10 shrimps/aquarium. G. verrucosa was extracted with ethyl acetate. Pacific white shrimp had been fed medicated feed three times daily 3% at satiation for 14 days. At 15th days, white shrimp were challenged with WSSV at 0.1 mL/shrimp intramuscularly. The results showed that the immune response shrimp (total hemocyte count, phagocytic activity, respiratory burst, and phenoloxidase activity) fed medicated feed increased significantly compared to positive and negative controls. The best relative percent survival post-challenge test was at 4 g/kg dose of G. verrucosa, i.e 41.07±3.09%. Confirmation of WSSV using PCR showed that shrimps (A, B, C, D, and K+) were positively infected by WSSV. It was concluded that 4 g/kg dose of G. verrucosa gave the best result to enhance immune response and resistance to WSSV infection. Keywords: seaweed, Gracilaria verrucosa, immunostimulant, Pacific white shrimp, WSSV ABSTRAK Penelitian ini bertujuan untuk menguji pengaruh pemberian ekstrak Gracilaria verrucosa melalui pakan dengan dosis yang berbeda untuk meningkatkan imunitas dan resistensi udang vaname terhadap serangan white spot syndrome virus (WSSV). Penelitian ini terdiri atas enam perlakuan dan masing-masing tiga ulangan, yaitu K- (tanpa ekstrak), K+ (tanpa ekstrak + infeksi WSSV), A (2 g/kg pakan + infeksi WSSV), B (3 g/kg pakan + infeksi WSSV), C (4 g/kg pakan + infeksi WSSV), dan D (5 g/kg pakan + infeksi WSSV). Udang vaname dengan bobot 6,07±0,10 g dipelihara dalam akuarium dengan ukuran (60×30×30) cm dengan padat tebar 10 ekor/akuarium. Udang diberi pakan perlakuan secara at satiation sebanyak tiga kali sehari selama 14 hari. Pada hari ke-15 diuji tantang dengan WSSV pada dosis 0,1 mL/ekor secara intramuskular. Hasil penelitian menunjukkan bahwa respons imun udang (total hemosit, aktivitas fagositik, respiratory burst, dan aktivitas fenoloksidase) yang diberi pakan mengandung ekstrak G. verrucosa mengalami peningkatan signifikan dibanding perlakuan kontrol positif maupun negatif. Relative percent survival terbaik pasca uji tantang pada perlakuan C (4 g/kg), yaitu 41,07±3,09%. Konfirmasi WSSV dengan menggunakan PCR menunjukkan hasil bahwa udang (A, B, C, D, and K+) positif terinfeksi WSSV. Disimpulkan bahwa dosis ekstrak G. verrucosa 4 g/kg pakan memberikan hasil terbaik untuk meningkatkan respons imun pada udang vaname  dan resistensi terhadap WSSV.   Kata kunci: rumput laut, Gracilaria verrucosa, imunostimulan, udang vaname, WSSV
MOLECULAR IDENTIFICATION OF PATHOGENIC BACTERIA AND PCR SPECIFIC PRIMER DESIGN Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5?-CAG GCC TAA CAC ATG CAA GTC-3?) and reverse primer 1387r (5?-GGG CGG WGT GTA CAA GGC-3?). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
CONSTRUCTION OF A DNA VACCINE USING GLYCOPROTEIN GENE AND ITS EXPRESSION TOWARDS INCREASING SURVIVAL RATE OF KHV-INFECTED COMMON CARP (CYPRINUS CARPIO) Nuryati, Sri; Alimuddin, Alimuddin; Sukenda, Sukenda; Soejoedono, Retno Damayanti; Santika, Ayi; Pasaribu, Fachriyan Hasmi; Sumantadinata, Komar
Jurnal Natur Indonesia Vol 13, No 1 (2010)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (120.942 KB) | DOI: 10.31258/jnat.13.1.47-52

Abstract

Deoxyribonucleic acid (DNA) vaccine has recently been developed as an alternative vaccine against virus infection.This study was the first step of DNA vaccine development to protect cyprinids including common carp (Cyprinuscarpio) and fancy koi (Cyprinus carpio) from KHV (koi herpesvirus) infection in Indonesia. One of KHV glycoproteingenes, i.e. glycoprotein (GP) was ligated with Japanese medaka (Oryzias latipes) â-actin promoter to generatepAct/GP as a DNA vaccine. Fourty fish in body weight of 10-15 g/fish were individually injected by pAct/GP intomuscle in different dosage of 2.5 ?g, 7.5 ?g and 12.5 ?g/100 ?l phosphate buffer saline. Total RNA was extractedfrom the 12.5 ?g of pAct/GP-injected fish muscle at 24, 48 and 67 hours post-injection to analyze GP expression byRT-PCR method. Potential of pAct/GP as DNA vaccine was examined by injecting KHV into the 30-days-vaccinatedfish. Both of possitive and negative control fish group were not vaccinated. Possitive control fish group wereinjected with KHV, but negative control fish group were not. KHV-challenged fish were reared for 1 month, and thedeath fish were calculated daily. Result of RT-PCR analysis showed that GP gene expression were detected at 3 dpost-injection. Expression of GP in the vaccinated fish groups helped to improve their survival rate after challengedby KHV. All of fish without DNA vaccination had dead 17 days after KHV injection. The results demonstrated thatpAct/GP had high potency to be used as a DNA vaccine against KHV infection in cyprinids.
TOKSISITAS PRODUK EKSTRASELLULAR (ECP) STREPTOCOCCUS AGALACTIAE PADA IKAN NILA (OREOCHROMIS NILOTICUS) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (919.679 KB) | DOI: 10.31258/jnat.13.3.187-199

Abstract

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: ?-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and ?-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae ?-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas ?-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than ?-haemolytic type.The conclusion from the research that ECP was virulent factor on ?-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.
Meningkatkan kemampuan pemahaman siswa dengan menggunakan metoda penemuan terbimbing pada pembelajaran geometri kelas 8 Sukenda, Sukenda; Umbara, Uba; Puadi, Evan Farhan Wahyu
JUMLAHKU: Jurnal Matematika Ilmiah STKIP Muhammadiyah Kuningan Vol 4 No 1 (2018): Edisi Vol. 4 No. 1 Mei
Publisher : Program Studi Pendidikan Matematika STKIP Muhammadiyah Kuningan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (395.231 KB)

Abstract

The purpose of the study was to investigate whether Guided Finding Methods could improve students' understanding of geometry in class 8. The method used is Classroom Action Research. The research was done at SMP Negeri 2 Ciwaru located at Jl. Raya Sumberjaya, Desa Citikur, Kecamatan Ciwaru, Kabupaten Kuningan. The subjects of the researchs were the students of SMP Negeri 2 Ciwaru class 8 academic year 2016/2017. They were chosen because after consulting with mathematics teachers that this had major problems regarding the comprehension ability of mathematical concepts. Data collection techniques: observation, interview and questionnaire. The research was done in 2 cycles, each cycle was done in 3 sessions. Each session includes 4 stages: planning, action, observation and reflection. The results of the research as follows: Learning with guided discovery method can improve students' understanding 73.82%. With the following details on the first cycle students who reached the KKM 17 students (62.54%) with an average score of 65.74. In cycle II the number of KKM 23 students (85.19%) the average score in cycle II was 79.26. Based on the results of the research it is advisable to use guided discovery methods in improving students' comprehension skills.
APLIKASI SINBIOTIK UNTUK PENCEGAHAN INFEKSI INFECTIOUS MYONECROSIS VIRUS PADA UDANG VANAME (LITOPENAEUS VANNAMEI) (SYNBIOTIC APPLICATION FOR PREVENTION OF INFECTIOUS MYONECROSIS VIRUS INFECTION IN WHITE SHRIMP (LITOPENAEUS VANNAMEI)) Widanarni, Widanarni; Sukenda, Sukenda; Septiani, Ghita Ryan
Jurnal Kedokteran Hewan Vol 10, No 2 (2016): J. Ked. Hewan
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v10i2.5041

Abstract

This study aimed to evaluate the effectiveness of dietary synbiotic at different giving frequencies on growth, immune responses, and resistance of white shrimp infected by infectious myonecrosis virus (IMNV). Synbiotic used in this study was combination of probiotic Vibrio alginolyticus SKT-b and prebiotic oligosaccharides extracted from sweet potatoe (Ipomoea batatas L). Doses of probiotic and prebiotic used were 1% and 2% (w/w), respectively. The white shrimps (0.493±0.035 g) were divided into five treatments consisting of A and B (without supplementation of synbiotic: (A) positive control; (B) negative control), C (daily synbiotic supplementation), D (twice a week synbiotic supplementation), and E (weekly synbiotic supplementation). After 30 days of feeding trial, white shrimps were infected by IMNV (except negative control). The results showed that daily growth rate of white shrimp on all synbiotic treatments (C, D, and E) ranged from 6.93±0.025-6.97±0.019% and had higher values than controls (A and B) (P 0.05). Meanwhile, feed conversion value in C and D (1.54±0.142 and 1.58±0.117) were lower than controls (P 0.05). Supplementation of synbiotic with different frequencies also affected survival rate of white shrimp after the challenge test with IMNV; daily synbiotic supplementation (C) resulted in a 50% higher survival rate than positive control (P 0.05). This was associated with immune responses parameters values of synbiotic treatment (before and after the challenge test) which were better than positive control. In conclusion the addition of synbiotic in feed resulted in higher growth performances, immune responses,and resistance of white shrimp to IMNV infection.