Charles Rangga Tabbu
Bagian Patologi Fakultas Kedokteran Hewan UGM Yogyakarta

Published : 16 Documents
Articles

Found 16 Documents
Search

DETEKSI DAN IDENTIFIKASI CEMARAN VIRUS AVIAN INFLUENZA PADA PASAR TRADISIONAL DI KABUPATEN ACEH BESAR DAN KOTA BANDA ACEH Helmi, Teuku Zahrial; Yulisma, Rika; Panjaitan, Budianto; Tabbu, Charles Rangga; Haryanto, Aris
Jurnal Sain Veteriner Vol 33, No 2 (2015): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (560.859 KB) | DOI: 10.22146/jsv.17920

Abstract

Penelitian ini dirancang untuk mendeteksi keberadaan virus AI pada beberapa titik kritis, yaitu unggas, kandang penampungan sementara, tempat pemotongan dan penjualan karkas, dan mengidentifikasi subtipe virus AI pada beberapa pasar tradisional di Kabupaten Aceh Besar dan Kota Banda Aceh, Propinsi Aceh. Sampel swab diambil secara acak (random) dari empat pasar di Kabupaten Aceh Besar dan Kota Banda Aceh, Propinsi Aceh, yaitu pasar Lambaro, Ketapang, Ulekareng dan Peunayong, dan dipoolkan. Satu pool sampel berisi 1 sampai 5 swab yang dikelompokkan berdasarkan pedagang, jenis unggas, dan titik kritis cemaran AI. Jumlahtotal sampel yang diambil adalah 314 swab, yang terdiri dari swab trakea unggas hidup, kandang penampungan, meja tempat pemotongan, dan karkas, kemudian dikelompokkan dalam 121 pool. Isolasi virus AI kedalam telur ayam bertunas (TAB), pemeriksaan secara serologis (uji HA/HI), dan identifikasi molekuler (metode RT-PCR) di lakukan di bagian Virologi Laboratorium Veteriner, dinas Kesehatan Hewan dan Peternakan Provinsi Aceh, dan Laboratorium Riset Terpadu Fakultas Kedokteran Hewan Universitas Syiah Kuala Banda Aceh. Analisis hasil pemeriksaan serologis dan identifikasi molekuler virus AI dilakukan dengan metode deskriptif. Hasilisolasi virus pada TAB menunjukkan bahwa embrio mengalami kematian pada 1 hari setelah di infeksikan dengan material virus dari sampel swab yang berasal dari pasar Lambaro Kabupaten Aceh Besar, dan titer antibodi terhadap virus AI hanya terdeteksi pada itik dan ayam pedaging yang berkisar antara 24 sampai dengan 27. Dari hasil serologis tersebut dilanjutkan dengan pemeriksaan RT-PCR. Berdasarkan hasil uji RT-PCR menggunakan primer spesifik terhadap gen M, H5, dan N1 diperoleh virus AI yang bersirkulasi pada unggas di pasar Lambaro tergolong subtipe H5N1. Hasil penelitian ini membuktikan bahwa diantara beberapa titik kritiscemaran virus AI di pasar tradisional, unggas hidup (itik dan ayam pedaging) yang berada dalam kandang penampungan sementara merupakan potensial penyebaran virus AI ke lingkungannya.
ISOLASI DAN IDENTIFIKASI VIRUS AVIAN INFLUENZA PADA BERBAGAI SPESIES UNGGAS SECARA SEROLOGIS DAN MOLEKULER (ISOLATION AND IDENTIFICATION OF AVIAN INFLUENZA IN DIFFERENT SPECIES OF POULTRY BY MEANS OF SEROLOGICAL AND MOLECULAR METHODS) Helmi, Teuku Zahrial; Tabbu, Charles Rangga; Artama, Wayan Tunas; Haryanto, Aris; Isa, Muhammad
Jurnal Kedokteran Hewan Vol 10, No 1 (2016): J. Ked. Hewan
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (259.428 KB) | DOI: 10.21157/j.ked.hewan.v10i1.3378

Abstract

The purpose of this research was to identify avian influenza (AI) virus using serological and molecular methods on poultry which suspected as AI infected in Aceh province. This study used 37 samples of tracheal and cloacal swabs and organs from various species of poultry that were collected from several districts/cities in Aceh. Samples were collected and put into transport media and stored at 4° C before sending to the laboratory. Samples were inoculated in specific pathogen-free of embryonated chicken egg with the age of 9-11 days for further serological and molecular examination. From 37 samples which infected to embryonated chicken egg then followed by hemagglutinin agglutination test/hemagglutinin inhibition revealed that 7 samples were positively infected with AI virus. The amplification result of specific matrix gene primer was followed by electrophoresis on 2% agarose gel which were obtained in the form of a deoxyribonucleic acid (DNA) band at 276 bp for matrix gene and 1.725 bp for H5 gene for all isolates test. In conclusion, the virus which caused the death of various types of poultry in Aceh province is avian influenza A virus subtype H5.Key words: avian influenza virus, H5N1, serologic, matrix, heamaglutinin
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB) | DOI: 10.22146/ijbiotech.7876

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
EFFECTS OF ACTIVE GUMBORO VACCINE OF INTERMEDIATE STRAIN HIGH PATHOGENICITY ON THE MORPHOLOGY OF BURSA FABRICIUS AND THE IMMUNE RESPONSE OF BROILER TO VACCINATION AGAINST NEWCASTLE DISEASE Tabbu, Charles Rangga
Jurnal Sain Veteriner Vol 16, No 1 (1998)
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.8606

Abstract

This experiment was designed to study the effects of active Gumboro vaccine of high pathogenicity on the morphology of bursa Fabricius and the immune response of broiler to vaccination against Newcastle disease (ND). This experiment was conducted in 330 broilers, which were vaccinated with aviive Gumboro vaccine of high, intermediate and low pathogenicity (control) at the age of 12 days. Experimental chickens were also vaccinated against ND at the age of 4 and 18 days. Diameter of bursas were measured at day 1st through 7th, 14th, 21th, 28th, 35th post Gumboro vaccination. Evaluation of hemaggutination inhibition (HI) liters against ND virus (NDV) were done only at day 7th, 14th, 2lth, 28th and 35th. Samples of bursa were stained with the method of hematoxylin and eosin (H & E). Pathologic evaluation revealed lesions in the bursa Fabricius of chickens vaccinated with Gumboro vaccine of high pathogenicity as well as changes in the diameter of bursa of lesions in this organ. The HI titers against NDV were lower in the group of chickens vaccinated with Gumboro vaccine of high pathogenicity compared with them of other groups. Results indicated that active Gumboro vaccine of high pathogenicity caused lesions in the bursa,which were similar to lesions caused by exposure to field Gumboro virus.
FIELD EVALUATION OF NEWCASTLE DISEASE VACCINE OF VG\GA IN STRAIN SEVERAL COMMERCIAL BROILER FARMS IN JAVA Tabbu, Charles Rangga
Jurnal Sain Veteriner Vol 15, No 1&2 (1996)
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.8643

Abstract

This field evaluation was conducted to study the level of protection, post vaccinal reactions and zootechninal performance of groups of chickens which have been vaccinated with Newcastle disease (ND) vaccine of VG/GA strain.This evaluation was done in 26.000 broilers from 4 farms, which have different condition in management practices and were located in different areas of Java.Chickens were vaccinated with VGAGA vaccine or with B-l/La Sota vaccine with/without inactivated ND. Serological tests were done at the age of 28 and 35 days, whereas challenge test with local ND virus isolates was done at the age of 45 days. Results of field evaluation indicated that in broilers, the VG/GA vaccine induced a high level of protection agamst the challenge test with a local (Indonesia) ND virus isolate and against infection with field ND virus. Statistical analysis indicated that the hemagglutination inhibition (HI) titers against NDV were significantly higher (P < 0,05) in group of chickens vaccinated with VG/GA with/without inactivated ND compared to group of chickens vaccinated with B-l/La Sota with/without inactivated ND vaccine. In certain conditions, the post vaccinal reactions were milder and the zootechnkal performance was better in groups of chickens vaccinated with VG/GA strain compared to groups vaccinated with B-l/La Sota.
IMMUNODIAGNOSIS INFEKSI AEROMONAS HYDROPHILA PADA IKAN Kristianingrum, Yuli Purwandari; Widyarini, Sitarina; Kurniasih, Kurniasih; Sutrisno, Bambang; Tabbu, Charles Rangga; Sugiyono, Sugiyono
Jurnal Sain Veteriner Vol 36, No 1 (2018): Juni
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (8456.913 KB) | DOI: 10.22146/jsv.38858

Abstract

Aeromonas hydrophila causes a disease that often infects fish and is known as Motile Aeromonas Septicaemia (MAS), Hemorrhagi Septisemia, Ulcer disease or Red-Sore disease. The   aims of this study were to develop polyclonal antibody of  Aeromonas hydrophila in the rabbits to   confirm the diagnosis of Aeromonas hydrophila  in the fish by immunohistochemistry staining method. Preparation of polyclonal antibodies was performed on the rabbits used to Aeromonas hydrophila bacteria that have been tested biochemically by intravenous and intraperitoneal injection. Doses of Aeromonas hydrophila  bacteria were 109 CPU/ml  of 0.5 ml at first injection, 1 ml at second injection, 2 ml at thirth injection and 3 ml at fourth injection. Blood serum collection was performed at week 5 after injection from  an  ear and intracardial vein. The result of antibody titer was 28 = 1024 which measured by   tube test. Furthermore, polyclonal   antibody was used to immunohistochemistry  staining with 400x dilution. The results of the staining showed that an immunopositive reaction in the liver, skin,lien,  gill, kidney, and heart of fish to Aeromonas hydrophila antibody. The research conclution was polyclonal antibody from rabbit can be used to accurately confirm the diagnosis of Aeromonas hydrophila  based on antigen and antibody reaction. 
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5&rsquo; ggagactcagcaatcccatgaaaag 3&rsquo; and H5-R:5&rsquo;ccataccaaccgtctaccattcc 3&rsquo;, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB)

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid.Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
AKUMULASI TIMAH HITAM DALAM DAGING DAN TULANG AYAM KAMPUNG DAN AYAM NEGERI (LEAD ACCUMULATION IN MEAT AND BONES OF DOMESTIC AND BROILER CHICKEN) ., Djohan; Tabbu, Charles Rangga
Jurnal Veteriner Vol 16 No 4 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (204.747 KB)

Abstract

Lead is a heavy metal polluting the environment, and its accumulation in animal or human bodies canhave neurotoxic and nephrotoxic effects on animals and human. Lead-contaminated chicken meat can bethe source of lead to human. Lead exposure to human can be assessed by measuring its concentration andaccumulation in chicken body parts and analyzing chicken consumption patterns. This study was conductedto measure lead concentrations in chicken body parts and to estimate lead exposure caused by consumptionof chicken body parts (breast, legs, wings) and tissues (meat, skin, cartilage, spongy bones). Samples wereextracted by using aqua regia digestible method with a mixture of HCl: HNO3 (3:1; v/v) and leadconcentrations were measured by the Atomic Absorption Spectrophotometry (AAS) method. The leadconcentrations in chicken tissues varied from&lt; 0.01 to 1.81?g.g-1dry weight.The average concentrations oflead in chicken tissues were lower than the recommended safety level of lead in chicken meat (1.0?g.g-1),except for the breast cartilage (1.03?g.g-1). The lowet accumulation level 2.6 ?g g-1 was found in domesticchicken wings while the highest of 32.9 ?g g-1 was found in broiler chicken breast (total of meat, skin,cartilage). Based on the data of lead accumulation in chicken tissues, a polynomial equation describing theprobability (P) to be exposed to certain amount of lead in chicken tissues (A, in ?g) was determined as P =-(1 x 10-3)A2 + (6,4 x 10-2)A.
DETEKSI BOVINE HERPESVIRUS-1 SECARA IMMUNOHISTOKIMIA PADA MEMBRAN KORIOALLANTOIS TELUR AYAM BEREMBRIO (IMMUNOHISTOCHEMISTRY DETECTION OF BOVINE HERPESVIRUS-1 IN CORIOALLANTOIC MEMBRANE OF CHICKEN EMBRYONATED EGG) Kristianingrum, Yuli Purwandari; Tabbu, Charles Rangga; Sutrisno, Bambang; Widyarini, Sitarina; ., Kurniasih; Untari, Tri; Kusumawati, Asmarani
Jurnal Veteriner Vol 16 No 4 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (143.278 KB)

Abstract

Infectious Bovine Rhinotracheitis (IBR) is caused by Bovine Herpes virus-1 in the cattle. The clinicalsigns demonstrate depression, anorexia, swelling of the vulva, redness of the vestibule, pustule and ulceron the vaginal mucosal. Based on previous research, IBR virus from the nasal swab could be grown inchorio-allantoic membrane of embryonated chicken eggs. This study aim was to confirm whether IBR virusin cattle could be grown in embryonated chicken eggs as a substitute for cell culture. A total of five nasalswab samples from the cows that were positive for IBR infection (diagnosed by Polymerase Chain Reactionand cell culture) were inoculated on the chorio-allantois membrane of embryonated chicken eggs.Observation of lesions performed at 3-5 days after inoculation. Re-inoculation (passage) was done threetimes. Pock characteristic lesions were observed on the corioallantoic membrane with the size of 5-7 mm,rounded shape, opaque edge, with necrosis in the central area. Furthermore, pock lesions were processedfor hematoxylin and eosin staining and immuno-histochemistry. The result of hematoxylin and eosinstaining showed that the formation of intranuclear inclusion bodies and vacuolization of the epithelial cellof membrane was observed. Immuno-histochemistry staining showed positive reaction for antibodiesagainst BHV-1 in the epithelial cells membrane. In conclusion, embryonated chicken eggs could be usedas a medium for detection of IBR.