Articles

Found 18 Documents
Search

EFEKTIVITAS ENROFLOKSASIN TERHADAP INFEKSI BAKTERI PADA SALURAN PENCERNAAN ULAR SANCA BATIK (PYTHON RETICULATUS) Wijayanti, Agustina Dwi; Untari, Tri; Rosetyadewi, Antasiswa W.; Rahardjo, Slamet
Jurnal Kedokteran Hewan Vol 7, No 2 (2013): J. Ked. Hewan
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v7i2.898

Abstract

Penelitian ini bertujuan mengetahui efektivitas enrofloksasin terhadap infeksi bakteri pada saluran pencernaan ular sanca batik (Python  reticulatus). Ular yang digunakan berjumlah 10 ekor dan terindikasi klinis mengalami gangguan pencernaan berupa keradangan pada mulut. Sampel yang diambil adalah swab mulut dan kloaka untuk pemeriksaan mikrobiologi berupa isolasi dan identifikasi bakteri pada media brilliant green agar, Mc Conkay agar, triple sugar iron, dan pembiakan isolat murni. Setelah pengambilan sampel semua ular diinjeksi dengan enrofloksasin 5 mg/kg bobot badan, dosis tunggal secara intramuskular anterior. Pengamatan klinis dilakukan hingga semua ular dinyatakan sembuh dari keradangan mulut. Hasil pemeriksaan mikrobiologi menunjukkan adanya bakteri Salmonella sp., E. coli, dan Proteus sp. pada saluran pencernaan ular. Enrofloksasin yang diberikan secara injeksi intramuskular anterior mampu memberikan kesembuhan dalam rentang waktu 4-16 hari setelah pemberian.
EVALUASI KIT DETEKSI CEPAT TERHADAP SAMPEL OTAK ANJING TERINFEKSI VIRUS RABIES Wibowo, Michael Haryadi; Untari, Tri; Artanto, Sidna; Amanu, Surya; Wahyuni, AETH.; Asmara, Widya
Jurnal Kedokteran Hewan Vol 9, No 1 (2015): J. Ked. Hewan
Publisher : Universitas Syiah Kuala

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21157/j.ked.hewan.v9i1.2797

Abstract

Penelitian ini bertujuan mengetahui potensi kit deteksi cepat Anigen® rapid test kit rabies Ag dalam mendeteksi virus rabies pada sampel otakanjing yang diperoleh dari lapangan yang meliputi batas deteksi, kecepatan reaksi, uji reaksi silang, uji sensitivitas, dan spesifisitas. Batas deteksi ditentukan dengan pengenceran secara serial kontrol positif virus rabies dan selanjutnya diuji dengan rapid test kit sesuai petunjuk produsen. Uji reaksi silang dilakukan dengan canine parvovirus, Escherichia coli, dan Salmonella sp. Uji sensitivitas dan spesifisitas dilakukan terhadap sampel otak yang telah dikonfirmasi positif rabies dengan uji fluorescent antibody technique. Konfirmasi uji rapid test tersebut dilakukan dengan reverse transcriptase polymerase chain reaction. Berdasarkan data yang diperoleh dalam penelitian ini dapat disimpulkan bahwa Anigen® rapid test kit rabies Ag mampu mendeteksi sampel yang mengandung virus rabies dengan titer 0,5 x log 106,5/0,03 ml, dengan rata-rata kecepatan reaksi 1,8 menit 29,35 detik (kurang dari 2 menit). Di samping itu Anigen® rapid test kit rabies menunjukkan tidak terdapat reaksi silang dengan canine parvovirus, Escherichia coli, dan Salmonella sp. serta mempunyai sensitivitas 92,30% dan spesifisitas 97,90%
The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Damayanti, Ema; Sofyan, Ahmad; Julendra, Hardi; Untari, Tri
Indonesian Journal of Animal and Veterinary Sciences Vol 14, No 2 (2009)
Publisher : Indonesian Animal Sciences Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (114.826 KB) | DOI: 10.14334/jitv.v14i2.348

Abstract

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum
PELACAKAN GEN ENV-TM VIRUS PENYAKIT JEMBRANA GALUR TABANAN 1995 DENGAN METODE NUCLEIC ACID SEQUENCE BASED AMPLIFICATON Kusumawati, Asmarani; Ratnawati, Atik; Wulandari, Ida Arlita; Hartati, Sri; Untari, Tri
Jurnal Veteriner Vol 16 No 4 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Jembrana disease is an infectious disease in Bali cattle cause by a member of lentivirus calledjembrana disease virus (JDV). It causes an acute and severe disease syndrome with short incubationperiod. As the disease has spread to several areas in Indonesia, a simple and rapid detection method isrequired. The objective of this study to apply rapid diagnostic method for JDVTabanan 1995 strain basedon Nucleic Acid Sequence Based Amplification (NASBA) methods targeting env-tm gene. The steps of thisresearch consisted of viral RNA isolation from organ and blood of cattle experimentaly infected withJDVTabanan 1995 strain . RNA amplification was conducted by NASBA using waterbath. The NASBAproducts were then separated on 2 % agarose gel. Using this technique JDV positive result was obtainedfrom organ samples such as spleen, liver, lung, prefemoralis lymph node, prescapularis lymph node andblood generating a RNA fragment of 207 bp. In this study, diagnosis method for env tm of JDV Tabanan1995 strain can be conducted by isothermal amplification NASBA.
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
STUDI LESI MAKROSKOPIS DAN MIKROSKOPIS EMBRIO AYAM YANG DIINFEKSI VIRUS NEWCASTLE DISEASE ISOLAT LAPANG YANG VIRULEN Putra, Hamdu Hamjaya; Wibowo, Haryadi; Untari, Tri; Kurniasih, Kurniasih
Jurnal Sain Veteriner Vol 30, No 1 (2012): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (7586.928 KB) | DOI: 10.22146/jsv.2468

Abstract

Newcastle disease (ND) disebabkan oleh Avian paramyxovirus dari keluarga Paramyxoviridae, merupakan salah satu penyakit utama pada ayam. Penelitian ini bertujuan untuk mengetahui lesi pada organembrio ayam secara makroskopis maupun mikroskopis yang diinfeksi oleh virus ND. Telur ayam berembrio (TAB) diinokulasi oleh virus ND Salatiga dan virus ND La Sota. Aquabidestilata digunakan sebagai kontrolnegatif. TAB yang menunjukkan kematian embrio disimpan di refrigerator, kemudian dikoleksi cairan allantoisnya. Embrio ayam yang mati dilakukan pengamatan secara makroskopis. Organ dari embrio ayam dibuat preparat histopatologi dengan pewarnaan Hematoxylin dan Eosin (H&E) untuk pemeriksaan mikroskopis. Identifikasi adanya pertumbuhan virus ND pada isolat dilakukan dengan uji hemaglutinasi dan uji hemaglutinasi inhibisi menggunakan serum anti ND. Embrio ayam yang diinfeksi oleh virus ND Salatiga mengalami kematian kurang lebih 26 jam pasca inokulasi. Lesi makroskopis yang teramati berupa hemoragipada kulit. Lesi mikroskopis menunjukkan adanya kongesti dan hemoragi pada paru-paru, kongesti dan radang pada kulit, serta kongesti pada usus, hati, ginjal, dan jantung. Embrio ayam yang diinfeksi virus ND La Sota secara makroskopis teramati kongesti ringan pada kulit. Lesi mikroskopisnya menunjukkan adanya kongesti pada paru-paru, kongesti dan radang pada kulit, serta kongesti pada hati, ginjal, dan jantung. Lesi makroskopis dan mikroskopis embrio ayam yang diinfeksi virus ND Salatiga lebih parah bila dibandingkan dengan lesi akibat virus ND La Sota.Kata kunci: Newcastle disease, embrio ayam, lesi makroskopis, lesi mikroskopis, La Sota
The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Damayanti, Ema; Sofyan, Ahmad; Julendra, Hardi; Untari, Tri
Jurnal Ilmu Ternak dan Veteriner Vol 14, No 2 (2009): JUNE 2009
Publisher : Indonesian Animal Sciences Society

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (114.826 KB) | DOI: 10.14334/jitv.v14i2.348

Abstract

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum
DETEKSI BOVINE HERPESVIRUS-1 SECARA IMMUNOHISTOKIMIA PADA MEMBRAN KORIOALLANTOIS TELUR AYAM BEREMBRIO (IMMUNOHISTOCHEMISTRY DETECTION OF BOVINE HERPESVIRUS-1 IN CORIOALLANTOIC MEMBRANE OF CHICKEN EMBRYONATED EGG) Kristianingrum, Yuli Purwandari; Tabbu, Charles Rangga; Sutrisno, Bambang; Widyarini, Sitarina; ., Kurniasih; Untari, Tri; Kusumawati, Asmarani
Jurnal Veteriner Vol 16 No 4 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Infectious Bovine Rhinotracheitis (IBR) is caused by Bovine Herpes virus-1 in the cattle. The clinicalsigns demonstrate depression, anorexia, swelling of the vulva, redness of the vestibule, pustule and ulceron the vaginal mucosal. Based on previous research, IBR virus from the nasal swab could be grown inchorio-allantoic membrane of embryonated chicken eggs. This study aim was to confirm whether IBR virusin cattle could be grown in embryonated chicken eggs as a substitute for cell culture. A total of five nasalswab samples from the cows that were positive for IBR infection (diagnosed by Polymerase Chain Reactionand cell culture) were inoculated on the chorio-allantois membrane of embryonated chicken eggs.Observation of lesions performed at 3-5 days after inoculation. Re-inoculation (passage) was done threetimes. Pock characteristic lesions were observed on the corioallantoic membrane with the size of 5-7 mm,rounded shape, opaque edge, with necrosis in the central area. Furthermore, pock lesions were processedfor hematoxylin and eosin staining and immuno-histochemistry. The result of hematoxylin and eosinstaining showed that the formation of intranuclear inclusion bodies and vacuolization of the epithelial cellof membrane was observed. Immuno-histochemistry staining showed positive reaction for antibodiesagainst BHV-1 in the epithelial cells membrane. In conclusion, embryonated chicken eggs could be usedas a medium for detection of IBR.
ISOLASI, IDENTIFIKASI, SIFAT FISIK, DAN BIOLOGI VIRUS TETELO YANG DIISOLASI DARI KASUS DI LAPANGAN (ISOLATION, IDENTIFICATION, PHISICAL, AND BIOLOGICAL CHARACTER OF NEWCASTLE DISEASE VIRUS ISOLATED FROM FIELD CASES) Wibowo, Michael Haryadi; Untari, Tri; Wahyuni, Anastasia Endang Tri Hastuti
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

native chicken farm suspected to Newcastle disease (ND) virus infection. Specimens were taken andcollected from the lung was further processed. Suspected materials were inoculated into allantoic sacc inspecific pathogenic free of 10 days embryonating egg chicken. The growth of the virus was determined withthe ability to agglutinate the chicken red blood cells or hemaglutination test. Positive hemaglutinationwas performed with hemaglutinatin inhibition test using specific antibody against ND virus. Method forND virus isolation, propagation and identification were based on the standard procedure of serologicalidentification for ND virus serological identification. 13 out of 34 samples were identified as ND viruses.Observation on the course and time of the virus to kill the chicken embryo could be differentiated intomoderate virus patho-type were 10 isolates and a virulent strains were 3 isolates. Further characterizationbased on the elution time observation indicated 11 isolates were not pathogenic strain and 2 isolates werenot virulent strain. Hemagglutinin stability study revealed that 11 isolates were sensitive being heated at560C for 30 minutes while 2 isolates were resistant. Biological characteristic of ND virus to hemagglutinateon various mammalian red blood cells indicating that most isolates were HA negative. Two isolates wereHA positive with cattle, horse and sheep red blood cell, and one isolate indicated positive HA test by usingsheep red blood cell. Control virus was lentogenic patho-type of La Sota strain showed HA and HI testpositive, elution time was 29 minutes, stability on the hemagglutinin after heating was 2 minutes and HApositive with cattle, horse and sheep red blood cell.
Evaluation of rapid detection kit against avian influenza A virus and H5 subtype for field Sample Wibowo, Michael Haryadi; Untari, Tri; Artanto, Sidna; Putri, Krisdiana; Amanu, Surya; Asmara, Widya
Indonesian Journal of Biotechnology Vol 21, No 1 (2016)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (846.082 KB) | DOI: 10.22146/ijbiotech.26792

Abstract

Avian influenza virus is poultry viral disease, which causes high economic losses. Various efforts have been made to control the disease. One effort is required screening fast and precise diagnostic test. This study was aimed to determine the potential of rapid test kit of AIV/H5 Anigen Rapid Test for the detection of AI virus types A and subtype H5 in the field. Some tests were carried out, e.g.: the potential test, cross-reaction test, sensitivity and specificity test. Potency test was done to evaluate potential of detection limits of the kit, by having the test of serial dilution of AI virus positive control. Cross-reaction test was done to detect antigens other than AI virus H5N1, e.g.:  IB virus of Massachuset strain, IBV strain 4-91, Newcastle Disease virus, and Escherichia coli. Sensitivity and specificity test were applied to the filed samples which clinically and laboratory were confirmed as H5N1 positive. To confirm the result of rapid test was then being done by reverse transcriptase polymerase chain reaction. Based on these results it can be concluded that, Anigen Kit AIV/H5 Ag Rapid Test can detect antigen-containing samples having AI virus HA titer up to 26of type A virus, and up to 25 for subtype H5 virus. Anigen Kit AIV/H5 Ag Rapid Test showed no cross-reactions with Infectious Bronchitis virus, Newcastle Disease virus, and Escherichia coli. Anigen A Rapid Test Kit AIV Ag showed a sensitivity of 50% and specificity of 100%, while Anigen Ag Rapid Test Kit AIV/H5 showed a sensitivity of 25% and specificity is 100%.