
Found 4 Documents

Effect of Adding Granul Basil (Ocimum americanum) as Antioxidants in Fried Foods Dinata, Deden I; Supriadi, Dadih; Djafar, Garnadi; Syerliana, Syerliana; Wijayanti, Wahyu; Suherman, Shelvy E
Indonesian Journal of Pharmaceutical Science and Technology Vol 2, No 1 (2015)
Publisher : Indonesian Journal of Pharmaceutical Science and Technology

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (471.482 KB) | DOI: 10.15416/ijpst.v2i1.7807


Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, analgetic, antiinflammatory, antivirus, antitumor, and antioxidants that prevented ischemia. This research aimed to investigate the effect of adding granule ethanol extract of basil leaves (Ocimum americanum) as antioxidant to capture free radicals in fried foods. The antioxidant activity of ethanol extract of basil leaves with DPPH determinated by IC50, comparing the antioxidant activity of the granule and the control by determination of quality properties of oil and food after frying using Fourier Transfor Infra Red (FTIR) spectra, and quantitative parameters by determination percentage of free fatty acid (FFA). Results of maceration with ethanol 15.94% w/w, total ash content 9.85%, water soluble ash content 3.98%, acid insoluble ash content 3.98%, water soluble extract 25.89%, ethanol soluble extract 12.76%, water content 6.87%, drying shrinkage 11.19%. Testing the antioxidant activity of the ethanol extract of basil leaves with DPPH gave IC50 of 80.55 ppm. The result of antioxidant testing by determination percentage of FFA statistically with ANOVA (significance 0.00<5) and comparison of the concentration extract in basil granule with LSD test significantly different. The result indicates that adding ethanol extract of granules basil on fried foods gave antioxidant activity because it can inhibit the increasing of FFA percentage. Keywords: Antioxidant, basil leaves, DPPH, granule
JURNAL FARMASI GALENIKA Vol 4 No 1 (2017): Jurnal Farmasi Galenika Volume 4 No 1, 2017
Publisher : Sekolah Tinggi Farmasi Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (376.616 KB)


Minuman probiotik adalah minuman fermentasi yang mengandung bakteri asam laktat (BAL) hidup dan bermanfaat bagi kesehatan sebagai sumber elektrolit, penawar racun, antioksidan, dan antibakteri. Pola hidup masyarakat Indonesia yang cenderung mengkonsumsi makanan tinggi lemak dan rendah serat menyebabkan munculnya berbagai masalah pencernaan. Minuman probiotik merupakan salah satu alternatif untuk menjaga kesehatan saluran cerna. Dari beberapa penelitian sebelumnya telah diketahui bahwa kandungan fenol dari air kelapa memiliki aktivitas antibakteri, antijamur dan antioksidan. Pada penelitian ini akan dilakukan proses fermentasi air kelapa menggunakan BAL. Proses tersebut diharapkan dapat meningkatkan aktivitas air kelapa sebagai minuman probiotik yang memenuhi Standar Nasional Indonesia. Metodologi penelitian ini meliputi penyiapan starter bakteri, penyiapan media air kelapa, fermentasi, formulasi, dan evaluasi. Starter yang digunakan dalam penelitian ini adalah kultur Lactobacillus plantarum dan Lactobacillus casei InaCCB75 yang dimasukkan kedalam media air kelapa dengan penambahan sukrosa. Minuman probiotik dibuat menjadi tiga formula dengan konsentrasi sukrosa yang berbeda, yaitu F1(5%); F2(7,5%); dan F3(10%). Hasil uji hedonik menunjukkan bahwa formula terbaik adalah F3 dengan total BAL112 ×1012CFU/mL; kandungan gula total 828,4 M; kadar asam laktat 0,69% dengan pH 3,58; dan TPT 13,36% Brix. Uji aktivitas antimikroba minuman probiotik air kelapa terhadap Escherichia coli, Staphylococcus aureus dan Candida albicans menunjukkan nilai lemah menuju sedang, sedangkan aktivitas antioksidan termasuk kedalam kategori kuat. Nilai evaluasi menunjukkan bahwa minuman probiotik air kelapa yang dihasilkan memenuhi persyaratan SNI (7552: 2009).
Publisher : Sekolah Tinggi Farmasi Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (318.147 KB)


Teh hijau (Camellia Sinensis L.) diketahui memiliki beberapa aktivitas farmakologi diantaranya adalah antioksidan. Penelitian ini bertujuan untuk membuat formula sediaan krim ekstrak etanol daun teh hijau sebagai pelindung terhadap paparan sinar ultraviolet. Krim dibuat dengan menggunakan bahan pembentuk krim fan wax sew-p 10%. Pengujian organoleptik terhadap sediaan krim meliputi pengamatan perubahan warna, bau, pH, dan homogenitas selama penyimpanan. Hasil menunjukan bahwa sediaan krim pelindung sinar ultraviolet dengan konsentrasi ekstrak 2%, 4%, 6%, dan 8% stabil selama penyimpanan. Pengamatan viskositas menunjukan adanya peningkatan viskositas selama pengamatan 28 hari. Hasil pengujian efektifitas sediaan dengan metode spektrofotometri ultraviolet diperoleh bahwa dengan bertambahnya konsentrasi ekstrak daun teh hijau dalam sediaan dapat meningkatkan nilai SPF (Sun Protector Factor) yaitu 2,32 untuk 2% ekstrak; 5,09 untuk 4% ekstrak; 6,71 untuk 6% ekstrak; sedangkan 7,48 untuk 8% ekstrak. Berdasarkan&nbsp; hasil ini dapat disimpulkan bahwa formula krim yang mengandung 2, 4, 6 dan 8% ekstrak teh hijau memiliki nilai SPF 2,32, 5,09, 6,71, dan 7,48 dapat digunakan sebagai sediaan pelindung&nbsp; terhadap paparan sinar ultraviolet.&nbsp;
Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR Muhsinin, Soni; Sulastri, Maria Martina; Supriadi, Dadih
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1065.944 KB) | DOI: 10.25077/jsfk.5.3.191-200.2018


Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.