Taukhid Taukhid, Taukhid
Unknown Affiliation

Published : 39 Documents

Found 39 Documents

Jurnal Riset Akuakultur Vol 15, No 1 (2020): Maret, 2020)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15578/jra.15.1.2020.%p


Koi herpesvirus (KHV) dan Aeromonas hydrophila adalah patogen yang dapat mengkoinfeksi ikan mas secara bersamaan. Penelitian ini bertujuan untuk mengembangkan metode duplex polymerase chain reaction (dPCR), deteksi simultan untuk diagnosis KHV dan bakteri Aeromonas hydrophila pada ikan mas. Dua pasang primer yang menargetkan sekuen spesifik SphI dan gen aerolisin, yang sering digunakan untuk mendeteksi KHV dan A. hydrophila dalam uji reaksi tunggal PCR dan menghasilkan target pita PCR 290 bp dan 417 bp. Hasil penelitian menunjukkan bahwa metode duplex PCR dapat mendeteksi ganda infeksi KHV dan A. hydrophila pada ikan mas dan metode ini lebih efektif mendeteksi dua patogen secara bersamaan dalam satu reaksi PCR pada suhu pradenaturasi, 94°C selama dua menit, denaturasi pada suhu 95°C selama satu menit, annealing pada suhu, 55°C selama satu menit, dan 72°C selama satu menit, dengan 30 siklus amplifikasi dan final extention pada suhu 72°C selama lima menit. Metode dPCR untuk deteksi simultan kedua patogen adalah salah satu metode yang dapat diaplikasikan untuk deteksi koinfeksi virus dan bakteri dalam satu reaksi PCR.Koi herpesvirus (KHV) and Aeromonas hydrophila are pathogens that can co-infect common carp. This study aimed to develop a duplex polymerase chain reaction (dPCR) method to detect KHV and Aeromonas hydrophila in common carp simultaneously. Two pairs of primers targeted the specific sequences of SphI and aerolysin genes, often used in detecting KHV and A. hydrophila, in a single PCR reaction test and produced target bands of PCR 290 bp and 417 bp. This proposed method was more effective in simultaneously detecting the two pathogens in one PCR reaction at pre-naturation temperature of 94°C for two minutes, denaturation at 95°C for one minute, annealing at temperature, 55°C for one minute, and 72°C for one minute, with 30 cycles of amplification and final extension at 72°C for five minutes. The findings showed that the duplex PCR method could be used to double detect KHV and A. hydrophila infection in common carp. The duplex PCR method for simultaneous detection of both pathogens is one method that can be applied for the detection of co-infection of viruses and bacteria in a PCR reaction.
APLIKASI VAKSIN Streptococcus agalactiae UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA BUDIDAYA IKAN NILA (Oreochromis niloticus) [Application of Streptococcus agalactiae vaccine to prevent streptococcosis on tilapia culture, Oreochromis niloticus] Taukhid, Taukhid; Lusiastuti, Angela Mariana; Sumiati, Tuti
BERITA BIOLOGI Vol 13, No 3 (2014)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (110.857 KB) | DOI: 10.14203/beritabiologi.v13i3.662


The research with the aim to know the effectivity (yield gap) of the application of Streptococcus agalactiae vaccine (pure whole cell) in prevention of streptococcosis on tilapia (Oreochromis niloticus) culture has been carried out. The isolate of S.agalactiae – N14G was used as a master seed on vaccine production. Priming vaccination was administered by immersion method, and booster vaccination was taken th place two months latter by oral method. Challenge test at the lethal dose (LD50) against active bacteria was done at 14 days post booster vaccination, and observation was taken place for 14 days post artificial infection. The results of the research showed that the highest survival rate and relative percent survival (RPS) was found in group treated with Streptovac vaccine (S. agalactiae and A. hydrophila combination) (65.58% and 35.36%) followed by S. agalactiae vaccine (52.08% and 10.01%). The lowest survival rate was found in control group (46.75%). The result of confirmation effectivity of the vaccines by challenge test in the laboratory showed that the highest survival rate and relative percent survival (RPS) was found in S. agalactiae vaccine (50.00% dan 37.50%) followed by Streptovac vaccine (40.00% and 25.00%), and the lowest survival rate was found in control group (20.00%). Vaccination is better than the non vaccinated.
OPTIMASI FREKUENSI PEMBERIAN VITAMIN C PAD A PAKAN KOMERSIAL UNTUK PENGENDALIAN PENYAKIT KOI HERPES VIRUS (KHV) PADA IKAN MAS (Cyprinus carpio Linn.) Taukhid, Taukhid; Lusiastuti, Angela Mariana; Suryadi, Kusumasari; Rosidah, Rosidah; Setiadharma, Gunawan
BERITA BIOLOGI Vol 10, No 3 (2010)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (529.665 KB) | DOI: 10.14203/beritabiologi.v10i3.749


The research with objective to understand optimization frequency of supplemented ascorbic acid (microencapsulated vitamin C CFC-90) feeding to control the Koi Herpes Virus (KHV) disease infecting common carp has been done in Fish Disease Laboratory Fishes were reared in plastic container (80 litres), with density of 20 fish sized 10 gram in average. The treatments were: (A) daily application, (B) three daily application, (C) five daily application, and (D) without vitamin C as a control. Examined fishes were challenged to KHV infection after the 21 days rearing period by cohabitation method for 2 weeks. Observations been done on behaviour, clinical signs and mortality of fishes. The results showed that the highest survival rate was found on the application o vitamin C given every 3 days (50.0%); followed by every day (12.5%), every 5 days (7.5%), and the lowest was found on contro group (1.3%). Control techniques in the case of KHV carp populations through the provision of vitamin C immunostimulatory conducted regularly since well before the existence of KHV infection provides the best protective level.
INFECTIOUS MYONECROSIS VIRUS (IMNV) IN PACIFIC WHITE SHRIMP, Litopenaeus vannamei IN INDONESIA Taukhid, Taukhid; Nur’aini, Yani Lestari
Indonesian Aquaculture Journal Vol 3, No 2 (2008): (December 2008)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (453.111 KB) | DOI: 10.15578/iaj.3.2.2008.139-146


The aquaculture industry in Indonesia has been growing rapidly and plays an important role in rural development and export earning. Penaeid shrimp culture in Indonesia has become a leading export earning in fisheries sector. The main constraint encountered with shrimp culture has always been associated with disease outbreaks, especially, caused by viral agents. The Pacific white shrimp (Litopenaeus vannamei) was unofficially introduced to Indonesia in 1999, and officially approved by Indonesian government in 2001. By the end of 2007, the Pacific white shrimp has been cultured in more than 17 provinces. The Taura Syndrome (TS) disease was detected in Indonesia in 2002, and the disease is currently found in at least 10 provinces. The Infectious Myonecrosis (IMN) is an emerging disease for L. vannamei in Indonesia, first detected in May-June 2006, causing significant mortalities in grow-out ponds. The IMN is characterized by an acute onset of gross signs: focal to extensive whitish necrotic areas in the striated muscle, especially on the distal abdominal segments and tail fan. White necrotic areas become reddened similar to the color of cooked shrimp. The outbreak resulted in elevated mortalities was initially associated with a chronic course of persistent low level mortalities. Up to date, IMN was detected in East Java, Bali, and West Nusa Tenggara provinces. This paper is a brief review of the epidemiological study of IMN disease of Pacific white shrimp in Indonesia: the status of outbreaks, surveillance, and disease diagnosis, and control measures.
SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus) Lusiastuti, Angela Mariana; Taukhid, Taukhid; Kusrini, Eni; Hadie, Wartono
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (905.847 KB) | DOI: 10.15578/iaj.4.2.2009.87-92


Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.
SURVEY OF VIRAL DISEASES OF PACIFIC WHITE SHRIMP, Litopenaeus vannamei IN INDONESIA Taukhid, Taukhid; Supriyadi, Hambali; Koesharyani, Isti
Indonesian Aquaculture Journal Vol 3, No 1 (2008): (June 2008)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (343.444 KB) | DOI: 10.15578/iaj.3.1.2008.59-68


Penaeid shrimp culture is a major contributor to foreign exchange earning in Indonesia. It has significant impact on economic development of fisheries sector, and leads to be one of prime mover to improve social prosperity. However, shrimp industry particularly black tiger shrimp (Penaeus monodon) has been facing unpredictable situation due to disease problem. The main constrain in correlation to the development of shrimp industry is disease outbreak, especially caused by viral agents. White Spot Syndrome Virus (WSSV) occurred in 1994, causing mass mortality of black tiger shrimp almost in all of the middle and western part of Indonesia. Due to the disease problem, it is estimated that in year 2000, more than 50% of shrimp pond were idle. Pacific white shrimp (Litopenaeus vannamei) or “udang vanamei” was introduced to Indonesia at the end of 1999, and released officially in July, 2001. Response of shrimp farmers to the shrimp rapidly accepted and distributed to many provinces in the country. At the end of 2006, distribution of white shrimp culture was encountered in more than 15 provinces. The seeds are mainly produced from hatcheries located in East Java and Lampung. The information of TSV in Indonesia was reported firstly from East Java at the end of 2002, without a clear history. Since then, survey of TSV distribution was conducted intensively in white shrimp production areas. Beside TSV, population of white shrimp coming to Indonesia also susceptible to White Spot Syndrome Virus (WSSV) and Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) infection. A survey with the aim to know significant viral diseases of white shrimp is needed to set up an alternative strategy to control them. The survey was conducted, firstly in the main production centers of white shrimp; and planned to be continued throughout the country. Samples collection, diagnostic method and data compiled in this study were collected from both active and passive surveillance. Diagnosis of viral diseases infecting white shrimp in this study was focused on TSV, WSSV, and IHHNV agents. Polymerase Chain Reaction (PCR) test has been used as a major diagnostic technique in this study. Progress report of the study showed that TSV spreading limited in controlled areas. The study proved that WSSV and IHHNV have been found in cultured white shrimp. All of the diseases mentioned above tend to be a significant constrain of future white shrimp industry in Indonesia, and special attention should be given in order to protect wide-spread of particular disease from infected to uninfected ones. Also, briefly current status of white shrimp culture development in the country will be discussed in this paper.
Indonesian Aquaculture Journal Vol 5, No 1 (2010): (June 2010)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (206.997 KB) | DOI: 10.15578/iaj.5.1.2010.45-51


The research with the aim to know the optimal feeding frequency of supplemented ascorbic acid (microencapsulated vitamin C CFC-90) on the dose of 750 mg/kg feed to control Koi Herpesvirus (KHV) disease infecting common carp has been done in field condition. Fish were reared in floating cages with the size of 3.5 m x 3.5 m x 2.0 m and stocking density of 1,250 fish/cage with the size range of ± 10 g/fish. The treatments applied in the research were: (A) daily application, (B) every 3 days application, and (C) without vitamin C addition as the control. Fish test were challenged to KHV infection on the mid cultivation by cohabitation method in the laboratory scale for 2 weeks. Examination on behavior, clinical sign, and mortality of fish test conducted daily. The results showed that the highest survival rate was found on the application of vitamin C every 3 days (60.16%); and followed by every day (52.00%), and the lowest was found on the control group (47.36%).
Media Akuakultur Vol 4, No 1 (2009): (Desember 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (65.608 KB) | DOI: 10.15578/ma.4.1.2009.67-72


Perkembangan vaksin pada ikan masih dalam tahap penelitian. Rencana strategis untuk pengembangan vaksin oleh peneliti merupakan pola dari riset yang dilakukan. Identifikasi antigen yang bersifat protektif, metode untuk produksi antigen protektif dalam kultur mikroba, metode bagaimana merubah bentuk antigen protektif menjadi bersifat imunogenik, merupakan tiga tahap yang dilakukan dalam riset tentang vaksin. Vaksin polivaleni adalah bentuk vaksin generasi baru yang memberikan perlindungan terhadap dua atau tiga penyakit pada saat yang sama jika dibandingkan dengan aplikasi satu atau dua vaksin secara terpisah. Keuntungan dari strategi ini adalah: sedikit jarum yang diinjeksikan, berkurangnya prosedur tata laksana, dan sumber daya manusia (SDM) yang digunakan. Dalam makalah ini juga dibahas keuntungan dan kerugian penggunaan vaksin polivalen serta tahap-tahap produksi vaksin tersebut.
Jurnal Riset Akuakultur Vol 7, No 2 (2012): (Agustus 2012)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (178.305 KB) | DOI: 10.15578/jra.7.2.2012.257-267


Epizootic Ulcerative Syndrome (EUS) adalah penyakit pada ikan yang disebabkan oleh infeksi jamur parasitik Aphanomyces invadans. Penelitian ini bertujuan untuk mendiagnosa patogen penyebab penyakit EUS melalui perpaduan 3 (tiga) basis pendekatan, yaitu: (1) gejala klinis, (2), isolasi patogen, dan (3) histopatologis. Sebanyak 30 ekor ikan uji diinfeksi spora jamur A. invadans secara buatan sebanyak 100 spora/ekor ikan melalui penyuntikan secara intra muskular (IM), dan 30 ekor lainnya diinjeksi dengan phosphate buffered saline (PBS) sebagai kontrol. Hasil penelitian menunjukkan bahwa gejala klinis yang muncul adalah timbulnya bercak-bercak merah pada tubuh ikan, selanjutnya berkembang menjadi ulser (ulcer) karena invasi hifa cendawan ke dalam otot/daging ikan. Hasil isolasi jamur dari ulser ditemukan adanya hifa aseptat dengan diameter 7,5-10,0 μm; memproduksi zoospora primer berbentuk cluster achloyd dan zoospora sekunder berbentuk biflagellata. Secara histopatologis ditemukan adanya invasi hifa dan sel granuloma (mycotic dermatitis granulomatosis).
EFIKASI VAKSIN IN-AKTIF BAKTERI Aeromonas hydrophila-AHL0905-2 (HYDROVAC) dan Streptococcus agalactiae-N14G (STREPTOVAC) UNTUK PENCEGAHAN PENYAKIT BAKTERIAL PADA IKAN BUDIDAYA AIR TAWAR Taukhid, Taukhid; Purwaningsih, Uni; Sugiani, Desy; Sumiati, Tuti; Lusiastuti, Angela Mariana
Jurnal Riset Akuakultur Vol 10, No 4 (2015): (Desember 2015)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (112.754 KB) | DOI: 10.15578/jra.10.4.2015.541-551


Penelitian bertujuan untuk mengetahui efektivitas penggunaan vaksin hydrovac dan streptovac untuk pencegahan penyakit bakterial, motile aeromonad septicaemia (MAS) dan streptococcosis pada beberapa jenis ikan budidaya air tawar. Pengujian dilakukan pada skala laboratorium dan lapang. Jenis ikan uji yang digunakan adalah ikan lele, nila, dan gurami. Vaksinasi ikan dilakukan melalui teknik perendaman dengan dosis dan periode sesuai instruksi penggunaan yang tertera pada label produk kedua jenis vaksin tersebut. Efektivitas vaksin dievaluasi berdasarkan pendekatan nilai persen sintasan dan selanjutnya dihitung nilai relative percentage survival (RPS). Hasil penelitian diketahui bahwa nilai RPS vaksin hydrovac pada skala laboratorium pada ikan lele, nila, dan gurami masing-masing sebesar 85,45%; 65,78%; dan 52,28%. Nilai RPS yang dicapai oleh vaksin streptovac terhadap ikan nila sebesar 54,53%. Sementara, nilai RPS vaksin hydrovac pada skala lapang untuk jenis ikan lele, nila, dan gurami masing-masing 70,15%; 52,43%; dan 42,43%; sedangkan nilai RPS yang dicapai oleh vaksin streptovac adalah 40,41%.