
PENGGUNAAN Chaetoceros calcitrans, Thalassiosira weissflogii DAN KOMBINASINYA PADA PEMELIHARAAN LARVA UDANG VANAME (Litopenaeus vannamei, Boone 1931) [The Use of Chaetoceros calcitrans, Thalassiosira weissflogii and Its Combination to The Larval Rearing of Vaname (Litopenaeus vannamei, Boone 1931)] Panjaitan, Amyda Suryati; Hadie, Wartono; Harijati, Sri
BERITA BIOLOGI Vol 14, No 3 (2015)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (641.496 KB) | DOI: 10.14203/beritabiologi.v14i3.1826


The use of one type live food in the larval rearing of vannamei shrimp is insufficient for maximum larval development. This research was aimed to evaluate the use of phytoplankton Chaetoceros calcitrans and Thalassiosira weissflogii and its combination as food to the growth and survivorship of white pacific shrimp Litopenaeus vannamei. The research used prawn larvae at stadia Nauplius4-5 with 150/ litre larval density. The larvae were fed and their effects with 3 kinds of live food, C. calcitrans (A), T. weissflogii (B), and combination of both types (C) for each treatment with five replications.The data was analysed using SPSSV.16. Result showed that the survival rate for treatment A was of 55.04+11.81%, treatment B was of 68.22+6.80%, and treatment C was of 77.04+4.63%. This indicated that treatment A gave significantly different on survival rate (P<0.01) than treatment B and C. Treatment B and C were not significantly different (P>0.05). We recomended the use of combination both of C. calcitrans and T. weisflogii to provide maximum survival rate for vannamei shrimp postlarvae.
PERBAIKAN MUTU GENETIK UDANG GALAH (Macrobrachium rosenbergii) BERDASARKAN SELEKSI FAMILI [Genetic Improvement of Giant Freshwater Prawn (Macrobrachium rosenbergii) based on Family Selection] Hadie, Lies Emmawati; Hadie, Wartono
BERITA BIOLOGI Vol 11, No 2 (2012)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (144.694 KB) | DOI: 10.14203/beritabiologi.v11i2.491


The base populations were composed to support selective breeding of giant freshwater prawn (Macrobrachium rosenbergii). Composite population were improved additive and dominance of genetic variance, especially for character of economic important. Economic character of giant freshwater prawn have a ratio of carapace length to standard length (ratio CL/SL).This research is aimed to improved the genetic of carapace and standard length ratio for giant freshwater prawn based on family selection. Selection methods were conducted on trait of carapace and standard length ratio as an edible portion. The base population prawn were used from three location i.e. Cimanuk (Cape of Air, West Java), Citanduy (Pamarican,West Java) and Musi River (Palembang, South Sumatra). Family selection was used selectedstructure. Parents were selected based on breeding value. Natural spawning was used product to first generation (F1) production of population. Larval rearing was used clear water system, fingerling production in the concrete tank, and juvenile rearing was conducted on earthen ponds. Respons selection was estimated to five months of freshwater prawn. Result of this experiment indicated that population of giant freshwater prawn can build by breeding program with heritability value of dressing out to 0.56+0.07; selection differential to 13.74 and selection intensity to 4.05. Prediction of genetic improvement from that genetic parameters is a value 7.69% to one generation. Implementation of population would be increased of genetic quality and there is decreased of gen degradation to prawn population.
The Growth Performance of Larasati tilapia (Oreochromis niloticus Linnaeus, 1758) Farming Using Bioflocs Technology Basuki, Fajar; Hastuti, Sri; Subandiyono, Subandiyono; Hadie, Wartono
Journal Omni-Akuatika Vol 13, No 2 (2017): Omni-Akuatika November
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (494.924 KB) | DOI: 10.20884/1.oa.2017.13.2.247


This research was aimed to discover the growth of converted Larasati tilapia (Oreochromis niloticus Linnaeus, 1758) using bioflocs system on its farming, the dynamics of its water quality, and the fish health condition. Bioflocs is the utilization of floc-forming bacteria (flocs forming bacteria) for sewage treatment. Waste mentioned in fish farming is particularly faeces and feed residue. This research took place at Laboratory of Aquaculture, Fisheries Department, Faculty of Fisheries and Marine Science of Diponegoro University. It started from May 2013 to August 2013. The design of the research was exploratory. The data of Larasati tilapia are from Janti, weighted 93.32 g or 200 fish per m3. The fiber tank with 2 m3 capacity is prepared for the bioflocs technique. The result shows that the growth of Larasati  tilapia with bioflocs system on its farming is better than with the conventional system. The survival rate SR reaches 90 % and food corvertion ratio FRC reaches 0.82. The water quality shows that there is oxygen dynamics around 4 mg · L–1 to 5 mg · L–1 and Amonia around 0.01 mg · L–1 to 0.015 mg · L–1. Based on the cell concentration and the blood chemistry, it can be concluded that the L.  tilapia with bioflocs system on its farming is healthy.
PENGGUNAAN VAKSIN Aeromonas hydrophila: PENGARUHNYATERHADAP SIANTAN DAN IMUNITAS LARVA IKAN PATIN (Pangasionodon hypophthalmus) Lusiastuti, Angela Mariana; Hadie, Wartono
BERITA BIOLOGI Vol 10, No 2 (2010)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (892.062 KB) | DOI: 10.14203/beritabiologi.v10i2.1967


Aeromonas hydrophila is a pathogen that often causes considerable losses in the area of freshwater fish fanning. Vaccination is one way to simulate parent catfish make specific immunity. Specific immunity generated by the parent will be forwarded through the oocytes produced during a certain time span. The aim of this research was to know the effect and the effectivity of using hydrovac vaccine with and without the complete adjuvant. This research was done on Patin fish Pangasionodon hypophthalmus whose givng Hydrovac 0.4 ml/kg of body weight. The comparation between complete adjuvant and vaccine was 1:1. Injection was done by intra peritoneal for three mothers each with and without complete adjuvant. Injection was done at gonad maturity level II. The result showed that antibody were positively detected on mother serum which used adjuvant or not. On larva stage, antibody was detected until four weeks old. While on 2 weeks old of larva, the concentration of titer antibody was very high and raised the dilution of 1: 2048. Survival rate of juvenile which their mother got a vaccine raised 93%, was better than 73%-63% using mother without vaccine. Booster immersion of hydrovac vaccine could give preferably at the end of three weeks old or in the beginning of fourth weeks old of larva.
SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus) Lusiastuti, Angela Mariana; Taukhid, Taukhid; Kusrini, Eni; Hadie, Wartono
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (905.847 KB) | DOI: 10.15578/iaj.4.2.2009.87-92


Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN ( on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.
EFEKTIVITAS MINERAL KALSIUM TERHADAP PERTUMBUHAN YUWANA UDANG GALAH (Macrobrachium rosenbergii) Hadie, Lies Emmawati; Hadie, Wartono; Prihadi, Tri Heru
Jurnal Riset Akuakultur Vol 4, No 1 (2009): (April 2009)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (102.2 KB) | DOI: 10.15578/jra.4.1.2009.65-72


Pertumbuhan udang galah dibatasi oleh kulitnya yang bersifat tidak elastis, karena terdiri atas khitin. Agar udang galah tumbuh dengan baik, maka harus ada unsur mineral dalam pakannya. Salah satu mineral yang bersifat esensial adalah mineral kalsium. Kalsium mempunyai fungsi dalam pembentukan tulang, jaringan lunak, proses regulasi dalam tubuh, dan menjaga keseimbangan asam basa. Oleh karena peran penting dari kalsium tersebut, maka dilakukan penelitian mengenai efek mineral kalsium dalam ransum pakan udang galah terhadap pertumbuhannya. Hewan uji yang digunakan pada penelitian ini adalah yuwana udang galah dengan kisaran bobot 56,0 ± 3,0 mg. Rancangan penelitian menggunakan Rancangan Acak Lengkap dengan perlakuan yang diterapkan adalah kalsium 1,0%; 3,0%; 5,0%; 7,0%; dan 0,0% sebagai kontrol. Setiap perlakuan mendapat 3 ulangan. Hasil penelitian ini menunjukkan bahwa kadar kalsium dalam ransum pakan sangat mempengaruhi laju pertumbuhan harian udang galah (P&lt;0,05). Kadar kalsium yang optimal dalam ransum pakan udang galah adalah sebesar 3,46%.The growth of giant prawn is limited by a non elastic material called chitin, which is a limiting factor in its growth. Feed containing mineral is needed to improve its growth. One of the essential minerals is calcium. The function of calcium is essential in bone and soft tissue formations, acid balancing, and regulation processes in the body. Because of its benefits, the research on the calcium effect on giant prawn was conducted. The aims of this study was to know the effect of calcium on the growth rate of giant prawn juvenile. Test animals were juveniles of giant prawn with average weight of 56.0 ± 3.0 mg. Research design employed complete randomized design with five calcium mineral treatments as follows:1.0%, 3.0%, 5.0%, 7.0%, and 0.0% as control. Each treatment has three replications. The result showed that calcium affected the daily growth rate of giant prawn (P&lt;0.05). The calcium dosage of 3.46% is the optimum level for giant prawn juvenile.
KERAGAMAN MORFOLOGI UDANG PAMA ( Penaeus semisulcatus ) DARI PERAIRAN SULAWESI SELATAN DAN SULAWESI TENGGARA Parenrengi, Andi; Sulaeman, Sulaeman; Hadie, Wartono; Tenriulo, Andi
Jurnal Riset Akuakultur Vol 2, No 1 (2007): (April 2007)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (174.118 KB) | DOI: 10.15578/jra.2.1.2007.27-32


Udang pama, Penaeus semisulcatus merupakan salah satu jenis krustase lokal yang memiliki prospek untuk dikembangkan sebagai kandidat spesies budi daya tambak. Penelitian ini bertujuan untuk mengetahui keragaman morfologi dan jarak genetik udang pama yang berasal dari Sulawesi Selatan dan Sulawesi Tenggara. Principle component analysis (PCA) dan discriminant analysis digunakan untuk mengetahui keragaman morfologi antar ketiga populasi alami udang pama. Hasil penelitian menunjukkan bahwa morfologi udang pama dari Munte dan Lampia (Sulawesi Selatan) berbeda dengan udang pama yang berasal dari Kassipute (Sulawesi Tenggara). Analisis kluster juga mengindikasikan adanya dua kluster utama, di mana kluster pertama merupakan gabungan antara udang pama dari Munte dan Lampia, sedangkan kluster lainnya adalah udang pama yang berasal dari Kassipute. Jarak genetik yang didapatkan memperlihatkan kekerabatan terdekat adalah udang pama yang berasal dari MunteLampia (5,424) dan terjauh pada udang pama yang berasal dari Lampia-Kassipute (48,350).Green tiger prawn, Penaeus semisulcatus is one of the prospective local crustaceans as a candidate species of shrimp pond culture. The objective of this study is to reveal the morphology diversity and genetic distance of green tiger prawn from South Sulawesi and Southeast Sulawesi. Principle component analysis (PCA) and discriminant analysis were used to analyze morphometric variations among the three natural populations. Result showed that the morphology of green tiger prawn from Munte dan Lampia (South Sulawesi) was relatively different with prawn collected from Kassipute (Southeast Sulawesi). Cluster analysis also indicated the existing of two main clusters i.e. green tiger prawn from Munte and Lampia as the first cluster and Kassipute as the second cluster. The lowest value of genetic distance was obtained from Munte-Lampia (5.424) and the highest genetic distance was obtained from Lampia-Kassipute (48.350).
Media Akuakultur Vol 4, No 1 (2009): (Desember 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (50.035 KB) | DOI: 10.15578/ma.4.1.2009.40-44


Survai keramba jaring tancap ikan bandeng (Chanos chanos) menjadi suatu studi yang menarik dibandingkan dengan daerah lain karena kegiatan dilakukan di muara sungai yang mengalami perkembangan sangat cepat, dimana pada awalnya bermula dengan 2 keramba sebagai percobaan, ternyata dalam kurun waktu 6 bulan sudah menutupi semua areal sungai sepanjang sekitar 4 km dengan 310 buah keramba. Kegiatan ini perlu menjadi perhatian Pemda setempat karena pada satu sisi kegiatan ini jelas akan meningkatkan produksi ikan dan meningkatkan pendapatan nelayan namun di lain hal kecepatan pertambahan jumlah keramba di luar batas daya dukung perairan, akan mendatangkan suatu risiko yang tinggi bagi keberhasilan kegiatan tersebut, bahkan dapat menyebabkan kematian total seperti yang sudah terjadi pada daerah-daerah lain, seperti di Waduk Cirata, Danau Maninjau, dan daerah lainnya.
Media Akuakultur Vol 3, No 1 (2008): (Juni 2008)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1479.848 KB) | DOI: 10.15578/ma.3.1.2008.54-63


Pemuliaan berbasis pembudidaya memerlukan integrasi program dan pelaksanaan yang sinergis antar semua stakeholder. Pemikiran, pencurahan waktu, dan upaya bersama antar sesama pembudidaya (user), pemulia (breeder), dan pemerintah dalam konteks pemuliaan berbasis pembudidaya dapat mengatasinya. Program yang seksama, manajemen yang konsisten, dan pemahaman lingkungan yang cermat akan memberikan hasil yang menguntungkan. Dengan ikan unggul, pakan yang memadai, dan lingkungan optimal, pembudidaya bisa memperoleh keuntungan maksimal. Dewasa ini kenyataan menunjukkan bahwa penggunaan benih varietas unggul bermutu oleh kalangan pembudidaya skala besar dan kecil, ternyata pada umumnya masih rendah untuk semua jenis ikan. Perkecualian terdapat antara lain pada usaha perikanan swasta yang bergerak pada ikan salmon dan nila. Benih varietas unggul bermutu untuk banyak komoditi, bahkan masih mengimpor, dan menghabiskan devisa cukup besar. Selain menghabiskan devisa, impor jenis hanya akan menguntungkan bagi negara pengekspor jenis tersebut. Rendahnya tingkat penggunaan benih varietas unggul dan bermutu untuk segala macam komoditi pertanian termasuk perikanan sesungguhnya membuka peluang bagi industri perbenihan dalam negeri, baik yang masih dalam taraf penangkar, maupun industri benih yang sudah mampu membuat varietas unggul baru sendiri. Selama ini hampir semua varietas unggul baru dari berbagai komoditi, dihasilkan oleh kelembagaan penelitian pemerintah dan perguruan tinggi.
ESTIMASI HERITABILITAS UDANG GALAH (Macrobrachium rosenbergii) BERBASIS PADA KERAGAMAN FENOTIP Hadie, Lies Emmawati; Hadie, Wartono; Sularto, Sularto
Jurnal Riset Akuakultur Vol 8, No 3 (2013): (Desember 2013)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (106.764 KB) | DOI: 10.15578/jra.8.3.2013.355-362


Penelitian ini dirancang untuk menghitung heritabilitas pada sifat bobot udang galah (Macrobrachium rosenbergii) pada umur lima bulan. Lima full-sib dan 15 half-sib dipelihara pada dua tingkat salinitas yaitu 0‰ dan 10‰, dengan rata-rata bobot sebesar 5,6 g; dan  = 0,40 g. Komponen keragaman diestimasi dengan mixed model leastsquares dan maximum likelihood. Hasil penelitian menunjukkan bahwa respons genetik yang tinggi dapat diperoleh melalui seleksi bobot, karena nilai heritabilitas pada sifat tersebut relatif tinggi. Hasil penelitian ini juga memperlihatkan bahwa kisaran nilai h2 pada air tawar (0,509-0,866) dan air payau (0,235-0,499). Jadi nilai h2 pada air tawar lebih tinggi dibandingkan dengan lingkungan air payau pada salinitas 10,0‰. Kisaran nilai h2 yang dicapai pada out-crossing antara koleksi Barito dengan Musi adalah 0,663±0,037-0,866±0,047. Implikasi dari hasil penelitian ini menunjukkan bahwa untuk menghasilkan perbaikan mutu genetik pada udang galah dapat ditempuh melalui program seleksi yang dikombinasikan dengan metode pemijahan secara out-crossing.