Contact Name
Contact Email
Journal Mail Official
Editorial Address
Kab. ogan ilir,
Sumatera selatan
Jurnal Penelitian Sains
Published by Universitas Sriwijaya
ISSN : -     EISSN : -     DOI : -
Jurnal Penelitian Sains (JPS) MIPA UNSRI merupakan wahana komunikasi ilmiah di bidang sains serta lintas ilmu yang terkait; diterbitkan sejak 1 Oktober 1996 oleh UP2M FMIPA Universitas Sriwijaya. Jurnal ini berisikan tulisan atau karangan ilmiah dalam berbagai bidang tersebut yang diangkat dari hasil penelitian, survei, atau telaah pustaka, yang belum pernah dipublikasikan dalam terbitan lain.
Arjuna Subject : -
Articles 13 Documents
Search results for , issue " Vol 10, No 1 (2007)" : 13 Documents clear
Penyerapan Ion Logan Zn (II) Menggunakan Batubara Lignit Asal Tanjung Enim Sumatera Selatan Fatma, Fatma; Sari, Sri Mulya; Rahmat, Addy
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3262.093 KB)


Penelitian mengenai penyerapan ion logam Zn menggunakan batubara lignit asal Tanjung Enim telah dilakukan. Kondisi optimum ditentukan dengan menvariasikan 3 parameter yaitu waktu pengadukan (3, 8, 15, 30, 45, 60, 90 mnt), pH (3, 4, 5, 6, 7) dan konsentrasi ion logam Zn (15, 20, 25, 30, 35, 40, 45 ppm). Pengukuran terhadap kadar ion logam Zn setiap variasi ditentukan dengan metode Spektrofotometri Serapan Atom. Hasil penelitian menunjukkan bahwa kondisi optimum penyerapan terhadap 20 ml larutan ion logam Zn tercapai pada waktu 60 menit, pH 5 dan konsentrasi 40 ppm. Daya serap terhadap ion logam Zn yang dihasilkan oleh adsorben pada kondisi optimum didapatkan sebesar 0,3536 mg/g.
Penentuan Konduktivitas Termal pada Tandan Kosong Sawit Sebagai Bahan Insulasi Termal Kaban, Hadir
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3638.12 KB)


Penelitian tentang tandan kodong sawit sebagai bahan insulasi termal telah dilakukan. Bahan insulasi yang digunakan antara fire retardant dan tandan kosong sawit adalah 30 : 70 dan perbandingan antara Alumina Hidrasi (Al2O3.3H2O) dan Calsium Carbonat (CaCO3) sebagai fire retardant adalah 40:60.Pengukuran konduktivitas dan tahanan termal dilakukan dengan variasi densitas bulk 0,35 gr/cm3, 0,40 gr/cm3, 0,45 gr/cm3, dilakukan variasi ketebalan 7 cm, 6 cm, 5 cm, 4 cm. Harga konduktivitas yang didapat dari hasil perhitungan adalah 0,095237 – 0,150698 W/mK dan tahanan termal 1,902067 – 2,87976 hr.ft2.F/Btu.
Gram-Schmidt dalam Menghitung Nilai Eigen Suatu Matriks Eliyati, Ning; Resti, Yulis
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3394.978 KB)


Penelitian ini bertujuan untuk menggunakan proses- Gram-Schmidt dalam menghitung nilai Eigen suatu matriks pada algoritma QR Ganda. Lazimnya dekomposisi QR pada suatu algoritma dilakukan dengan rotasi atau refleksi. Dengan menggunakan proses Gram-Schmidt yaitu proses ortonormalisasi dari satu basis ke basis lainnya, dekomposisi matriks orthogonal Q dan matriks segitiga atas R membentuk matriks Hessenberg atas.
Metode Reed-Merrel dalam Menyusun Tabel Kematian Singkat (Abridged Life Table) dengan Pendekatan Integral Euler-Maclaurin Resti, Yulia
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (4619.188 KB)


Penelitian ini bertujuan menyusun Tabel Kematian Singkat (TKS) pada metode Reed-Merrell dengan pendekatan integral Euler-MacLaurin dan menerapkannya pada data penduduk Kecamatan Rambutan Jakarta Selatan tahun 1990. Dengan pendekatan tersebut, diperoleh tiga komponen utama TKS. Komponen pertama adalah nmx=mx+(n/2), komponen kedua , dan komponen terakhir . Dengan menerapkannya pada data diperoleh usia harapan hidup penduduk wanita 59,4112 tahun sedangkan penduduk pria 53,8197 tahun.
Sistem Kontrol On/Off Menggunakan SMS (Short Message Service) Berbasis Mikrokontroler AT89C52 Saleh, Khairul; Koriyanti, Erry; Alfarizi, Ali
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5531.842 KB)


Modul sistem kontrol berbasis mikrokontroler AT89C52 ini dirancang untuk melakukan pengiriman SMS (Short Message Service) agar dapat mengktifkan atau menonaktifkan beberapa alat listrik. Dalam mikrokontroler ini, dibuat dalam mode teks formal PDU (Protocol Data Unit), PDU terdiri dari sistem penyanfian pasangan-pasangan bilangan heksa desimal agar dapat dimengerti oleh mikrokontroler Modul Sistem dirancang menggunakan mikrokontroler AT89C52, Telephone Seluller Receiver kemudian melakukan aksi mengaktifkan atau menonaktifkan led sesuai perintah dalam isi SMS. Dari hasil perancangan dan simulasi, alat ini dapat melakukan responnya dengan baik sesuai dengan perintah isi SMS dalam simulasi ini dilakukan pengujian dengan beberapa aspek yaitu pengujian perintah-perintah dalam SMS, waktu pengiriman SMS hingga aksi yang dilakukan dengan varisi beberapa jenis kartu seluller.
Penapisan Aktivitas Antibakteri Tumbuhan Famili Annonaceae Salni, Salni; Harmida, Harmida; Vivin M, Vivin M
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5895.49 KB)


Penelitian “Penapisan Aktivitas Antibakteri Tumbuhan Famili Annonaceae” telah dilakukan pada bulan Mei sampai November 2004. Pengambilan sampel dilakukan di Hutan Lindung Suaka Margasatwa Isau-isau Kabupaten Lahat dan Talang Ratu, Km 5 Palembang Penelitian ini bertujuan untuk mengetahui jenis-jenis tumbuhan famili Annonaceae yang mempunyai aktivitas antibakteri, menentukan Konsentrasi Hambat Minimum (KHM) serta golongan senyawa kimia ekstrak tumbuhan famili Annonaceae yang aktif. Uji aktifitas antibakteri dilakukan dengan metode difusi agar, bakteri uji yang digunakan adalah Escherichia coli dan Staphylococcus aureus. Hasil penelitian menunjukkan bahwa ekstrak dari lima jenis Annonaceae dapat menghambat pertumbuhan Escherichia coli dan Staphylococcus sureus. Diperoleh 5 macam ekstrak tumbuhan yang mempunyai diameter hambatan yang besar pada konsentrasi 2% yaitu batang Annona reticulata L., kulit batang Annona aquamosa L., kulit bantang Cananga odorata Hook. f. & Thomson, kulit batang Cananga sp, dan daun Cananga sp. Nilai Konsentrasi Hambatan Minimum (KHM) 5 macam ekstrak etanol kulit batang Annona reticulata L. Annona squamosa L., Cananga odorata Hook. f. & Thomson, Canangan sp, dan daun Canangan sp terhadap Escherichia coli adalah 0,1%, sedangkan terhadap Staphylococcus aureus adalah 0,05%.   
Triterpenoid Pentasiklik dari Fraksi Aktif Diklorometana Daun Sari Rapet (Ficus delteoidea Jack) Anwar, Lenny; Ferlinahayati, Ferlinahayati; Fikri, Emir
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (4304.12 KB)


Telah dilakukan isolasi dan identifikasi triterpenoid dari fraksi diklorometana daun sari rapet dengan metoda maserasi menggunakan pelarut metanol, fraksinasi dengan pelarut: n-heksana, diklorometana dan etil asetat. Fraksi diklorometan menunjukkan aktifitas sitotoksik dengan LC50=246 ppm. Dari fraksi diklorometan berhasil diisolasi padatan amorf berwarna putih dengan titik leleh 251-253°C dan positif triterpenoid. Spektrum ultraviolet memperlihatkan serapan pada λmaks=203 dan 223 (bahu) nm yang berasal dari transisi πà π* untuk ikatan rangkap terisolasi. Spektrum inframerah senyawa hasil isolasi memberikan puncak-puncak serapan pada bilangan gelombang 3420 cm-1 untuk gugus –OH dan 1042 cm-1 untuk gugus CO alkohol, 2942-2869 cm-1 untuk gugus C-H alifatik, 1682-1620 cm-1 untuk C=C tak terkonjugasi, 1454 cm-1 untuk tekuk C-H alifatik dan 1382 cm-1 untuk gem dimetil. Kromatogram GC memberikan satu puncak dengan waktu retensi 7,0 menit. Spektrum massa menunjukkan puncak dasar m/z 133, tetapi puncak ion molekul (M+) tidak teridentifikasi. Berdasarkan data spektroskopi diatas maka diusulkan bahwa senyawa hasil isolasi merupakan golongan triterpenoid pentasiklik yang memiliki gugus hidroksil dan ikatan ganda dua terisolasi.
Pemetaan Sebaran Lamun di Perairan Teluk Tomini Provinsi Gorontalo Dahlan, Zulkifli; Nofrizal, Nofrizal
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5091.987 KB)


Pemetaan sebaran lamun di perairan Tanjung Kramat dan Torosiaji di Teluk Tomini Provinsi Gorontalo telah dilakukan pada bulan juli 2005. Peta tentang sebaran lamun merupakan informasi dasar dalam pengelolaan lamun d wilayah ini. Posisi sebaran lamun dilakukan dengan menentukan koordinat titik-titik terluar dari padang lamun menggunakan alat Geographic Positioning System (GPS). Data yang diperoleh dikonversi ke dalam decimal degree untuk digambarkan dalam bentuk peta dengan bantuan perangkat lunak Surfer versi 07. Jenis lamun di perairan Tanjung Kramat terdiri dari Thalassemia hemprichii, Halophila minor dan Syringodium isoetifolium, di Perairan Torosiaji di susun oleh Enhalus acoroides, Thalassemia hemorichii, Halodule uninervis dan Cymodoceae rotundata.
Pengaruh Ekstrak Kuda Laut (Hippocampus Kuda Bleeker) Terhadap Spermatogenesis Mencit (Mus musculus L.) Jantan Setiawan, Arum; Windusari, Yuanita
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (5893.34 KB)


Penelitian ini untuk mengetahui pengaruh ekstrak kuda laut (Hippocampus kuda Bleeker) terhadap histologi tubulus seminiferus mencit (Mus musculus L.) jantan. Penelitian ini dirancang menggunakan RAL yang terdiri atas 7 kelompok yaitu sebagai kontrol diberi akuades dan perlakuan diberi ekstrak kuda laut dosis 75, 125, 175, 225, 275 dan 325 mg/kg bb. Masing-masing perlakuan diulang sebanyak 4 kali. Perlakuan diberikan secara gavage dengan volume 0,1 ml/10 g bb selama 34 hari. Hasil penelitian menunjukkan bahwa ekstrak kuda laut dengan dosis 75, 125, 175, 225, 275 dan 325 mg/kg bb menyebabkan berubahnya struktur histologi tubulus seminiferus. Hal ini ditandai dengan lebih rapatnya asosiasi sel-sel spermatogenik dan terjadi peningkatan secara nyata jumlah rata-rata cacah spermatogonia, spermatosit dan spermatid. Jumlah total sel-sel spermatogenik meningkat sejalan bertambahnya dosis yang diberikan dibandingkan dengan kontrol kecuali pada dosis 75 mg/kg bb tidak berbeda nyata dari kontrol terhadap jumlah rata-rata spermatogonia dan spermatosit.
Rancangan Primer Untuk Aplikasi Gen Pengkode Kitinase dari Bacillus Substillis Mardiyanto, Mardiyanto; Yusuf, Setiawan
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (4505.191 KB)


Telah dilakukan penelitian tentang perancangan primer untuk aplifikasi gen pengkode kitinase dari Bacillus substillis. Hasil perancangan dan amplifikasi akan dipergunakan untuk proses overproduksi kitinase yang akan dimanfaatkan pada bidang kesehatan dan pertanian. Dari proses perancangan diketahui bahwa gen pengkode kitinase dari Bacillus substillus ditemudi cds tidak dimulai dari basa pertama dan ada 186 basa dihitung dari strat kodon, primer yang dihasilkan tidak memperlihatkan empat basa yang berurutan menempel pada kondisi self dimmer ataupun hair pin loop. Urutan primer yang siperoleh adalah Forward aaaagggggtgaacaaaatagagt dan Revearese acacggtcgtcgtcagcaagta

Page 1 of 2 | Total Record : 13