L. Hartanto Nugroho
Biology Department, Universitas Gadjah Mada, JalanSekip Utara, Yogyakarta

Published : 3 Documents Claim Missing Document
Claim Missing Document

Found 3 Documents

Aktivitas Antiproliferatif Ekstrak Wasbensin Daun Eupatorium riparium Reg. : Studi In Vitro Pada HeLa Cell lin Yhani Chrystomo, Linus; Nugroho, L. Hartanto; Wahyuono, Subagus; Krishar Karim, Aditya; Terada, Kumiko; Nohno, Tsutomu
Biota Biota Volume 18 Nomor 1 Tahun 2013
Publisher : PBI Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (314.37 KB)


Eupatorium riparium Reg. adalah tumbuhan obat penting asli dari Mexico dan India Barat, yang masuk ke tanah Jawa sejak tahun 1800. Tumbuhan ini mempunyai catatan sejarah digunakan untuk obat tradisional dalam berbagai kultur budaya bangsa secara luas di seluruh dunia dan biasa digunakan untuk obat hipertensi, gagal jantung, diuretik, antikanker, antifungi, dan penyakit yang disebabkan oleh bakteri. Studi pada HeLa cell line ini dilakukan selama satu bulan. Selanjutnya, studi ini bertujuan meneliti aktivitas antiproliferatif ekstrak wasbensin daun E. riparium terhadap kanker servik manusia Hela cell line. Aktivitas antiproliferatif diuji menggunakan reagen proliferatif sel WST-1 dengan waktu 1, 2, dan 4 jam setelah diinkubasi selama 72 jam pada suhu 37oC dan 5%CO2. Hasil penelitian menunjukkan bahwa ekstrak wasbensin daun E. riparium mempunyai aktivitas proliferatif yang potensial terhadap HeLa cell line dengan nilai IC50 berikut 102.69 𝜇g/ml (1 jam), 198.67 𝜇g/ml (2 jam). Saran selanjutnya, penelitian lanjutan perlu dilakukan untuk mengetahui mekanisme antikanker HeLa cell line.Kata kunci: Eupatorium riparium Reg, antiproliferatif, HeLa, WST-1
CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon) Raharjo, Tri Joko; Rizki, Rosyida Azis; Ethica, Stalis Norma; Rustanti, Elly; Nugroho, L. Hartanto
Indonesian Journal of Chemistry Vol 11, No 3 (2011)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (338.3 KB) | DOI: 10.22146/ijc.21388


Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5 GTTCCACCTGCGAAGCAGCC 3) and GGR2 (5 CTGGATCGCACATCC TGGTG 3) primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Aktivitas Antiproliferatif Ekstrak Wasbensin Daun Eupatorium riparium Reg. : Studi In Vitro Pada HeLa Cell lin Yhani Chrystomo, Linus; Nugroho, L. Hartanto; Wahyuono, Subagus; Krishar Karim, Aditya; Terada, Kumiko; Nohno, Tsutomu
Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati Vol 18, No 1 (2013): February 2013
Publisher : Universitas Atma Jaya Yogyakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (314.37 KB) | DOI: 10.24002/biota.v18i1.260


Eupatorium riparium Reg. adalah tumbuhan obat penting asli dari Mexico dan India Barat, yang masuk ke tanah Jawa sejak tahun 1800. Tumbuhan ini mempunyai catatan sejarah digunakan untuk obat tradisional dalam berbagai kultur budaya bangsa secara luas di seluruh dunia dan biasa digunakan untuk obat hipertensi, gagal jantung, diuretik, antikanker, antifungi, dan penyakit yang disebabkan oleh bakteri. Studi pada HeLa cell line ini dilakukan selama satu bulan. Selanjutnya, studi ini bertujuan meneliti aktivitas antiproliferatif ekstrak wasbensin daun E. riparium terhadap kanker servik manusia Hela cell line. Aktivitas antiproliferatif diuji menggunakan reagen proliferatif sel WST-1 dengan waktu 1, 2, dan 4 jam setelah diinkubasi selama 72 jam pada suhu 37oC dan 5%CO2. Hasil penelitian menunjukkan bahwa ekstrak wasbensin daun E. riparium mempunyai aktivitas proliferatif yang potensial terhadap HeLa cell line dengan nilai IC50 berikut 102.69 𝜇g/ml (1 jam), 198.67 𝜇g/ml (2 jam). Saran selanjutnya, penelitian lanjutan perlu dilakukan untuk mengetahui mekanisme antikanker HeLa cell line.Kata kunci: Eupatorium riparium Reg, antiproliferatif, HeLa, WST-1