Contact Name
Yori Yuliandra
Contact Email
Journal Mail Official
Editorial Address
Kota padang,
Sumatera barat
Jurnal Sains Farmasi & Klinis
Published by Universitas Andalas
ISSN : 24077062     EISSN : 24425435     DOI : -
Core Subject : Health, Science,
Jurnal Sains Farmasi & Klinis (J Sains Farm Klin) adalah jurnal ilmiah di bidang kefarmasian yang diterbitkan oleh Fakultas Farmasi Universitas Andalas bekerjasama dengan lembaga profesi "Ikatan Apoteker Indonesia" (IAI) daerah Sumatera Barat sejak tahun 2014.
Arjuna Subject : -
Articles 226 Documents
Gambaran Kadar Elektrolit (Natrium dan Kalium) Darah, Tekanan Darah dan Denyut Nadi Pasien Terapi Gagal Jantung di RSUP Dr. M. Djamil Padang Suhatri, Suhatri; Elfi, Eka Fitra; Marsellinda, Elsa
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (378.673 KB) | DOI: 10.25077/jsfk.5.3.243-246.2018


Gangguan elektrolit merupakan komplikasi yang berbahaya pada pasien gagal jantung. Gangguan ini dapat disebabkan oleh patofisiologis perkembangan penyakit gagal jantung pada masing – masing pasien ataupun oleh efek samping terapi obat gagal jantung yang diterima seperti diuretik, glikosida jantung, dan inhibitor sistem renin-angiotensin-aldosteron. Tujuan dari penelitian ini adalah untuk mengetahui gambaran kadar elektrolit (natrirum dan kalium); tekanan darah sistolik dan diastolic; dan denyut nadi saat admisi; setelah satu minggu; dan setelah satu bulan mendapat terapi obat gagal jantung di RSUP Dr. M. Djamil Padang. Pengambilan data dilakukan secara retrospektif terhadap rekam medis pasien pada tahun 2017. Analisis data gambaran dianalisis menggunakan uji T berpasangan (paired T-test).  Dari pengumpulan data diperoleh 27 pasien yang memenuhi kriteria inklusi dan eklusi. Hasil penelitian menunjukkan bahwa tidak terdapat hubungan secara bermakna (P > 0,05) antara kadar elektrolit (kalium dan natrium) pada saat admisi; setelah satu minggu; dan setelah satu bulan terapi obat gagal jantung). Namun, juga diketahui bahwa terdapat hubungan secara bermakna (P < 0,05) antara tekanan darah sistolik dan diastolic; dan denyut nadi saat admisi; setelah satu minggu; dan setelah satu bulan mendapat terapi obat gagal jantung.
Studi Prospektif Adverse Drug Reactions (ADRS) Obat Hipoglikemik Oral Terhadap Pasien Diabetes Mellitus Tipe 2 di Suatu Rumah Sakit, Padang Yosmar, Rahmi; Inanta, Nadia Putri; Sari, Yelly Oktavia
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (518.271 KB) | DOI: 10.25077/jsfk.5.3.169-175.2018


Diabetes melitus tipe 2 merupakan penyakit gangguan metabolisme lemak, protein dan karbohidrat yang banyak dijumpai pada masyarakat. Terapi farmakologi diabetes melitus tipe 2 salah satunya dilakukan dengan pemberian obat hipoglikemik oral (OHO) yang dapat menyebabkan kemungkinan terjadinya Adverse Drug Reactions (ADRs). Jenis ADRs yang umum terjadi adalah reaksi tipe A (Augmented) yaitu reaksi yang diperkirakan sebelumnya dan bergantung pada dosis obat. Tujuan penelitian ini adalah untuk mengetahui karakteristik sosiodemografis pasien dan mengevaluasi angka kejadian serta jenis ADRs yang ditimbulkan oleh obat hipoglikemik oral pada pasien diabetes melitus tipe 2 di poliklinik penyakit dalam RSUP Dr. M. Djamil Padang periode Juli – September  2018. Metode yang digunakan adalah observasional dengan pengumpulan data secara prospektif. Setiap ADRs aktual yang terjadi dihitung probabilitasnya dengan menggunakan algoritma Naranjo scale.  Hasil penelitian ini menunjukkan sebanyak 37 sampel yang memenuhi kriteria inklusi, dimana 51,35% berjenis kelamin wanita dan berusia >56 tahun sebanyak 59,46%. Pola penggunaan obat hipoglikemik oral yang paling banyak digunakan adalah kombinasi metformin dengan glimepirid sekitar 32,43 %. Penelitian ini dapat disimpulkan bahwa 8,1 % pasien mengalami kasus ADRs. Obat hipoglikemik oral yang diduga menjadi penyebab timbulnya ADRs tersebut adalah metformin dan metformin-glimepirid dapat menyebabkan mual dengan kategori possible ADRs serta metformin-glimepirid-acarbose yang menyebabkan terjadinya flatulensi dengan kategori probable ADRs.  
Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR Muhsinin, Soni; Sulastri, Maria Martina; Supriadi, Dadih
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1065.944 KB) | DOI: 10.25077/jsfk.5.3.191-200.2018


Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.
Pengetahuan dan Sikap tentang Obat pada Orangtua Siswa SD di Kota Padang Syofyan, Syofyan; Indra, Hivzil; Suryati, Suryati; Almahdy, Almahdy
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (509.807 KB) | DOI: 10.25077/jsfk.5.3.212-217.2018


Masalah keamanan obat pada anak seringkali diabaikan oleh orang tua. Anak masih dianggap sebagai pengguna pasif padahal anak sesuai dengan perkembangannya telah memiliki otonomi dalam penggunaan obat-obatannya sendiri. Untuk itu, anak perlu diberdayakan sesuai dengan pengetahuannya dibawah pengawasan orang tua. Penelitian ini bertujuan untuk melihat gambaran pengetahuan dan sikap orangtua tentang obat pada anak. Disain penelitian yang digunakan menggunakan disain studi kuantitatif dengan pendekatan cross sectional. Dari peneitian ini didapatkan bahwa pengetahuan orang tua siswa SD di kota Padang tentang obat dikategorikan sedang(69,20 %). Sedangkan sikap orang tua menunjukan sikap positif dengan persentase sikap positif (97,4%). Tidak adanya hubungan yang bermakna antara tingkat pengetahuan dan sikap  orang tua siswa SD di kota Padang. (P>0,05). Faktor yang mempengaruhi pengetahuan yaitu uhuamur, tempat tinggal, pekerjaan, pendidikan terakhir, dan tempat penyimpanan obat responden. Tidak adanya hubungan yang bermakna antara semua karakteristik terhadap sikap responden. Dapat disimpulkan bahwa perlu edukasi kepada orangtua agar dapat memberikan informasi tentang keamanan obat pada anak.   
Evaluasi Terapi  Adjuvant Hormonal  Dan Hubungannya Terhadap Outcome  Klinis  Pasien Kanker Payudara Stadium  Dini Di Kota Padang windrasari, wessi; Wahyuni, Fatma Sri; Khambri, Daan
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.5.3.176-184.2018


Terapi adjuvant hormonal merupakan pilihan terapi yang efektif bagi pasien kanker payudara stadium dini dengan hormonal responsif dan Her-2 negatif. Outcome klinis dari terapi kanker payudara adalah Disease Free Survival (DFS), Overall Survival (OS). Penelitian ini bertujuan mengevaluasi terapi adjuvant hormonal dan pengaruhnya terhadap outcome klinis pasien. Penelitian ini merupakan penelitian deskriptif dengan desain cross sectional study menggunakan data retrospektif registrasi kanker payudara Persatuan Ahli Bedah Onkologi Indonesia (PERABOI) Kota Padang selama periode 2008-2017. Analisis data menggunakan Kaplan Meier Analysis dengan Log rank. Diperoleh sebanyak 58 orang pasien yang memenuhi kriteri inklusi, dengan rerata umur yaitu 49,41 ± 8,69 tahun, kejadian relaps 22,4% dan sebanyak 6,9% pasien mengalami kematian. Terapi terbanyak pada pasien premenopause adalah tamoxifen (58,3%), pada pasien pascamenopause adalah Aromatase Inhibitor (54,5%). Secara statistik pada pasien premenopause tidak ada pengaruh terapi adjuvant hormonal yang berbeda terhadap DFS (P log rank test 0,243 dan HR = 0.513) dan OS (P log rank test 0,545 dan HR = 0.314). Pada pasien pascamenopause tidak ada pengaruh terapi yang berbeda terhadap DFS (P log rank test 0,586 dan HR = 0,10) dan OS (P log rank test 0,594 dan HR = 0,12).
Evaluasi Sitotoksik Alfa Mangostin Pada Kultur Sel Leukosit Manusia Secara In Vitro dan Uji Aktivitas Antioksidan Wahyuni, Fatma Sri; Sudji, Ikhwan Resmala; Amaliyah, Rizki Amaliyah
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (637.829 KB) | DOI: 10.25077/jsfk.5.3.201-206.2018


Ekstrak kulit manggis telah banyak digunakan sebagai obat herbal untuk pengobatan berbagai penyakit dan pemeliharaankesehatan. Senyawa kimia utama dari ekstrak kulit manggis adalah α-mangostin. Bioaktivitas senyawa alfa mangostin telah diuji secara ekstensif pada berbagai organisme in vitro. Namun, informasi tentang efek keamanannya belum diketahui. Penelitian ini bertujuan untuk meninjau keamanan alfamangostin dengan mengevaluasi aktivitas sitotoksik dari alfa mangostin pada kultur sel leukosit normal dan aktivitas antioksidan dari α-mangostin. Evaluasi sitotoksik dilakukan dengan 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT assay)dan aktivitas antioksidan dilakukan menggunakan1,1-difenil-2-pikrilhidrazil (DPPH assay). Konsentrasi alpha mangostin yang diuji yaitu: 3.125 μg/mL; 6,25 μg/mL; 12,5 μg/mL; 25 μg/mL; 50 μg/mL dan 100 μg/mL. Hasilnya menunjukkan bahwa alfa mangostintidak memiliki efek toksik padakulturselleukosit. Alfamangostin mampu memicu respon proliferasi sel leukosit pada 50 μg/mL dengan viabilitas sel 208,485 ± 21,21% dan pada 100 μg/mL dengan viabilitas sel 361.818 ± 86,37%. Alpha mangostinjuga menunjukkan aktivitas antioksidan yang kuat dengan nilai IC5013,57 μg/mL. Hasil penelitian ini membuktikan bahwa alfa mangostin tidak toksikpada sel leukosit manusia sehingga aman untuk dikonsumsi. Sebagai senyawa antioksidan alfamangostin dapat memicu proliferasi sel leukosit dalam kultur sel leukosit.
Perubahan Parameter Biokimia, Histopatologi Ginjal Tikus Spraque Dawley Pascahipoksia Oleh Ekstrak Akar Acalypha indica dan Herba Centella asiatica Nurfitri, Nurfitri; Purwaningsih, Erni Hernawati; Soetikno, Vivian; Dwijayanti, Adisti; Hardiany, Novi Silvia
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (731.281 KB) | DOI: 10.25077/jsfk.5.3.160-168.2018


Hipoksia kronik merupakan salah satu penyebab penyakit ginjal akibat peningkatan pembentukan Reactive Oxygen Species (ROS)  dalam sel. Kombinasi ekstrak akar Acalypha indica 250 mg/KgBB (AI250) dan Centella asiatica 150 mg/kgBB (CA150) memiliki efek neuroterapi pada tikus Spraque Dawley pascahipoksia. Penelitian dilakukan untuk membuktikan manfaat kombinasi ekstrak etanol dan/atau ekstrak tunggalnya dapat memperbaiki kerusakan ginjal tikus pascahipoksia melalui mekanisme antioksidan. 28 tikus jantan dikelompokkan dalam 7 kelompok: kontrol normal; kontrol hipoksia+air; hipoksia+(AI200+CA150); hipoksia+(AI250+CA100); hipoksia+AI250; hipoksia+CA150; hipoksia+vitamin C. Hipoksia selama 7 hari dalam hypoxic chamber berisi O2 10% dan N2 90%, 1 atm. Setiap kelompok diberi perlakuan selama 7 hari. Pada akhir studi hewan diterminasi. Darah dan organ ginjal diambil untuk pemeriksaan biokimia dan histopatologi.Kombinasi  (AI250+CA100) menurunkan kadar MDA ginjal dan plasma secara bermakna dibandingkan kontrol hipoksia (p=0,001 dan p=0,021) dan AI250 (p=0,003 dan 0,043). Kombinasi AI250+CA100 terjadi penurunan ekspresi relatif mRNA HIF-1α (p=0,014), kadar urea plasma (p=0,001) dan perbaikan lesi intra-glomerulus p=0,013.Kesimpulan: Kombinasi (AI250+CA100) dan tunggal AI250 memiliki aktivitas antioksidan terbaik dalam mencegah kerusakan ginjal pascahipoksia, secara biokimiawi dan histopatologinya.
Pengembangan Instrumen Pemantauan Efek Samping Obat: Efek Samping Obat Pada Pasien Strok Iskemik Almasdy, Dedy; Sari, Yelly Oktavia; Ilahi, Habibie Tifan; Kurniasih, Nina
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (510.315 KB) | DOI: 10.25077/jsfk.5.3.225-232.2018


Stroke iskemik merupakan penyakit vaskular yang terjadi ketika pasokan darah ke otak berkurang akibat penyumbatan pembuluh darah. Pengobatan stroke menggunakan beberapa obat seperti antiplatelet, antihipertensi dan antihiperlipidemia. Salah satu masalah penggunaan obat adalah timbulnya efek samping. Penelitian ini bertujuan untuk mengkaji efek samping obat pada pasien stroke iskemik di instalasi rawat inap Neurologi suatu rumah sakit pemerintah di Padang. Penelitian dilakukan secara prospektif selama 3 bulan. Data diambil dari rekam medis pasien dan hasil wawancara dengan pasien stroke iskemik yang telah menggunakan obat selama lebih dari 3 hari dan terdapat 32 orang pasien termasuk dalam kriteria inklusi. Obat-obat yang diamati adalah aspirin, klopidogrel, amlodipin, bisoprolol dan simvastatin. Efek samping obat yang dicurigai dianalisis dengan algoritma Naranjo dan disesuaikan dengan skala potensi efek samping obat. Hasil penelitian menunjukkan 11 pasien yang diduga mengalami efek samping obat. Terdapat 6 pasien (54,5 %) mengalami anemia, urtikaria, nausea dan insomnia yang disebabkan penggunaan obat aspirin, 3 pasien (27,3 %) mengalami nausea, edema dan insomnia yang disebabkan penggunaan obat amlodipin, 1 pasien (9,1 %) mengalami rash yang disebabkan penggunaan obat klopidogrel dan 1 pasien (9,1 %) mengalami dispnea yang disebabkan penggunaan obat bisoprolol. Hasil penelitian ini menyimpulkan bahwa terdapat 6 dugaan efek samping obat termasuk kategori possible dan 5 dugaan efek samping obat kategori probable.
Studi Penggunaan Obat Untuk Menangani Gangguan Natrium dan Kalium Pasien Penyakit Ginjal Terminal di RS Muhammadiyah Bandung Yusri, Yunisa Friscia; Amalia, Lia; Lisni, Ida
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (497.864 KB) | DOI: 10.25077/jsfk.5.3.233-242.2018


Penyakit ginjal terminal dapat menyebabkan terganggunya pengaturan keseimbangan Natrium (Na) dan Kalium (K). Gangguan tersebut dapat disebabkan oleh fungsi ginjal yang menurun dan pengaruh antihipertensi golongan penghambat SRAA (Sistem Renin Angiotensin Aldosteron) seperti ACEI (Angiotensin-Converting Enzyme Inhibitor) dan ARB (Angiotensin Receptor Blocker). Gangguan ini dapat menyebabkan aritmia, edema otak, henti jantung hingga kematian. Penelitian ini bertujuan untuk mengetahui penggunaan obat serta pengaruh penggunaan antihipertensi ACEI dan ARB terhadap gangguan Na dan K pada kondisi pasien pradialisis. Penelitian ini merupakan penelitian deskriptif-potong lintang (cross-sectional) pada kondisi pasien pradialisis di Rumah Sakit Muhammadiyah Bandung. Dari penelitian diperoleh 22 pasien yang memenuhi kriteria inklusi, yaitu pasien yang memiliki hasil pengukuran kadar Na dan K pada kondisi pradialisis. Dari 22 pasien tersebut sebanyak 59,09% mengalami hiponatremia, 45,45% mengalami hiperkalemia, dan 4,55% mengalami hipokalemia. Untuk mengatasi kondisi hiponatremia digunakan infus NaCl 3%. Sedangkan untuk mengatasi kondisi hiperkalemia digunakan furosemid, kalsium glukonat, dan kalsium polistiren sulfonat baik tunggal maupun kombinasi. Gangguan Na dan K harus segera diatasi untuk mencegah terjadinya kerusakan sel. Penggunaan antihipertensi ACEI, ARB maupun kombinasi keduanya secara statistik tidak bermakna yang berarti tidak terdapat pengaruh penggunaan obat tersebut terhadap munculnya kondisi hiponatremia maupun hiperkalemia pada pasien.Kata kunci: Hiponatremia, Hiperkalemia, ACEI, ARB
Perbandingan Kejadian Reaksi Obat yang Tidak Dikehendaki Antara Kontrasepsi Suntik Tunggal dan Kombinasi di Kota Bengkulu Putri, Yona Harianti; Andrajati, Retnosari; Yanuar, Arry
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (464.972 KB) | DOI: 10.25077/jsfk.5.3.154-159.2018


Reaksi obat yang tidak dikehendaki (ROTD) adalah salah satu penyebab akseptor menghentikan penggunaan kontrasepsi. Penghentian kontrasepsi dapat meningkatkan kejadian kehamilan yang tidak dikehendaki. Penelitian ini bertujuan untuk mengetahui perbandingan kejadian ROTD dari penggunaan kontrasepsi suntik tunggal (Depo Medroksi Progesteron Asetat) dan kontrasepsi suntik kombinasi (MPA/Estradiol Sipionat). Desain penelitian adalah cross sectional uji dua populasi. Jumlah sampel sebanyak 65 akseptor kontrasepsi suntik tunggal dan 62 akseptor kontrasepsi suntik kombinasi. Kejadian ROTD dianalisis menggunakan Chi-Square dan uji regresi logistik multivariat. Hasil penelitian menunjukkan kejadian ROTD gangguan menstruasi lebih banyak terjadi pada akseptor kontrasepsi suntik tunggal (89.2%) dibanding akseptor kontrasepsi suntik kombinasi (38.7%) dengan P-value <0.001. Kejadian ROTD mudah marah lebih banyak terjadi pada akseptor kontrasepsi suntik tunggal (67.7%) dibanding akseptor kontrasepsi suntik kombinasi (46.8%) dengan P-value 0.017. Kejadian ROTD kurang gairah seksual lebih banyak terjadi pada akseptor kontrasepsi suntik tunggal (56.9%) dibanding akseptor kontrasepsi suntik kombinasi (37.1%) dengan P-value 0.025. Kejadian ROTD sakit kepala lebih banyak terjadi pada akseptor kontrasepsi suntik tunggal (56.9%) dibanding akseptor kontrasepsi suntik kombinasi (50.0%), akan tetapi perbandingannya tidak signifikan (P-value 0.434). Kejadian ROTD gangguan menstruasi 13 kali lebih banyak terjadi pada akseptor kontrasepsi suntik tunggal dibanding kombinasi.

Page 1 of 23 | Total Record : 226