Contact Name
Contact Email
Journal Mail Official
Editorial Address
Kab. badung,
Jurnal Veteriner
Published by Universitas Udayana
ISSN : -     EISSN : -     DOI : -
Core Subject : Health,
Jurnal Veteriner memuat naskah ilmiah dalam bidang kedokteran hewan. Naskah dapat berupa: hasil penelitian, artikel ulas balik (review), dan laporan kasus. Naskah harus asli (belum pernah dipublikasikan) dan ditulis menggunakan bahasa Indonesia atau bahasa Inggris. Naskah ilmiah yang telah diseminarkan dalam pertemuan ilmiah nasional dan internasional, hendaknya disertai dengan catatan kaki
Arjuna Subject : -
Articles 922 Documents
Pengembangan Vaksin Inaktif Tetelo Genotipe VII Isolat Lokal pada Kondisi Laboratorium. (DEVELOPMENT OF TETELO INACTIVATED VACCINE GENOTYPE VII LOCAL ISOLATE IN LABORATORY CONDITION) Indriani, Risa; Dharmayanti, Ni Luh Putu Indi
Jurnal Veteriner Vol 17 No 3 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (181.05 KB)


Tetelo/Newcastle disease (ND) inactive vaccine of genotipe VII virus local isolate have been developedin laboratory condition and compared with commercial ND vaccine. A total of 200 commercial layer chickenat 4 weeks age were divided into four groups, that were (1) vaccinated with ND genotype VII Indonesia/GTT/11, (2) vaccinated with commercial ND vaccine genotype VII, (3) vaccinated with commercial genotypeVI and (4) unvaccinated as control group. After two weeks post vaccination, 10 chicken from each groupwere sellected randomly and challenged with 105 EID50 per 0,1 mL of ND virus genotype VII Indonesian/GTT/11 by intramuscular. Chicken were observed, and swab were collected from oropharyngeal and cloacaat 2, 5, 7, 12 and 14 days post challenge. The result of this study showed inactived vaccine genotype VIIIndonesia/GTT/11 can induced a good antibody titer response to vaccinated chicken with mean titer 7.30log2 and CI 6.3 to 7.8, while commercial ND vaccine genotipe VII was 5.30 log2 with CI 3.8-6.7, andcommercial genotype VI was 4.8 log2 with CI 4.1-5.4. The level of protection which determined by noclinical signs, mortality and viral shedding showed 100% protection in chicken vaccinated with Indonesia/GTT/11 and commercial genotype VII were 100%, compared with control chicken, and vaccined commercialND vaccine genotype VII, compared with control chicken. While in chicken vaccinated commercial NDvaccine genotype VI showed viral shedding on day two post challenge, but there were no clinical sign andmortality. Based on this results, Indonesia/GTT/11 genotype VII ND vaccine could be used as an alternativeND vaccine to protect chicken from infection of ND virus genotype VII in the field.
Sistem Pemeliharaan Anjing dan Tingkat Pemahaman Masyarakat terhadap Penyakit Rabies di Kabupaten Bangli, Bali (DOG REARING SYSTEM AND UNDERSTANDING LEVEL OF PEOPLE IN BANGLI, BALI TOWARD RABIES DISEASE) Nugraha, Elisabeth Yulia; Batan, I Wayan; Kardena, I Made
Jurnal Veteriner Vol 18 No 2 (2017)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (182.6 KB) | DOI: 10.19087/jveteriner.2017.18.2.274


Rabies is a zoonotic fatal disease. The disease infects the central nervous system, known as encephalitis. This study aims were to determine the relationship between the percentage and the factors that influence the maintenance system and the level of public awareness toward rabies in Bangli Regency, Bali. A total of 140 questionnaires were distributed in 14 villages that have never been reported having cases of rabies. Interview data were analyzed using quantitative descriptive analysis and dendrogram. The results showed that a proper dog care system in Bangli associated with dog rearing conditions (100%); provided awareness of the feed (100%); the number of feeding more than one each day (91.4%); rabies vaccination status (83.6%); not keeping other rabies transmitted animals (cat) (75.7%); health inspection status (67.1%); and the number of dogs that were kept not more than one tail (55.7%). Bad dog maintenance systems associated with the type of feed given (100%); contact with other dogs (80%); and system maintenance by way of detachable dogs (73.6%). The level of public understanding in Bangli district was well connected with the mobility of dogs (88.6%); understanding of the dangers of rabies (79.3%); dog origin (79.3%); knowledge of the characteristics of rabies (74.3%); and the village of rabies free status was retained (78.6%). Poor level of public understanding related to the lack of village rules and custom rules relating to rabies (100%); lack of community participation in education programs (62.1%); and how to have dogs (52.1%). Based on the results of this study, its concluded that the maintenance system of dogs and the level of public understanding regarding rabies in Bangli are relatively good. ABSTRAK Rabies adalah penyakit zoonosis yang bersifat mematikan. Penyakit ini menyerang sistem saraf pusat atau encephalitis. Penelitian ini bertujuan untuk mengetahui persentase dan hubungan antara faktor-faktor yang memengaruhi sistem pemeliharaan dan tingkat pemahaman masyarakat terhadap penyakit rabies di Kabupaten Bangli, Bali. Jumlah responden yang diambil sebanyak 140, tersebar di 14 desa yang belum pernah dilaporkan terjadi kasus rabies. Data hasil wawancara berdasarkan kuisioner dianalisis menggunakan analisis deskriptif kuantitatif dan dendrogram. Hasil penelitian menunjukkan bahwa sistem pemeliharaan anjing yang baik di Kabupaten Bangli berhubungan dengan kondisi pemeliharaan anjing (100%); kesadaran memberikan pakan (100%); jumlah pemberian pakan yang lebih dari satu kali (91,4%); status vaksinasi rabies (83,6%); tidak memelihara hewan penular rabies (HPR) selain anjing (kucing) (75,7%); status pemeriksaan kesehatan (67,1%); dan jumlah anjing yang dipelihara tidak lebih dari satu ekor (55,7%). Sistem pemeliharaan anjing yang buruk berhubungan dengan jenis pakan yang diberikan (100%); berkontak dengan anjing lainnya (80%); dan sistem pemeliharaan anjing dengan cara dilepas (73,6%). Tingkat pemahaman masyarakat Kabupaten Bangli yang baik berhubungan dengan mobilitas anjing (88,6%); pemahaman mengenai bahaya rabies (79,3%); asal anjing (79,3%); pengetahuan mengenai ciri-ciri rabies (74,3%); dan status desa bebas rabies yang masih dipertahankan (78,6%). Tingkat pemahaman masyarakat yang buruk berhubungan dengan belum adanya aturan desa maupun aturan adat yang berkaitan dengan penyakit rabies (100%); kurangnya pastisipasi masyarakat dalam program penyuluhan (62,1%); dan cara memperoleh anjing (52,1%). Berdasarkan hasil penelitian dapat disimpulkan bahwa sistem pemeliharaan anjing dan tingkat pemahaman masyarakat mengenai penyakit rabies di Kabupaten Bangli tergolong baik.
Pelacakan Virus Bercak Putih pada Udang Vaname (Litopenaeus vannamei) di Lombok dengan Real-Time Polymerase Chain Reaction (DETECTION OF WHITE SPOT SYNDROME VIRUS IN LITOPENAEUS VANNAMEI IN LOMBOK ISLAND USING REAL-TIME POLYMERASE CHAIN REACTION) Arafani, Lulu; Ghazali, Mursal; Ali, Muhamad
Jurnal Veteriner Vol 17 No 1 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (180.869 KB)


White spot syndrome virus (WSSV) is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara) using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei) were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .
Studi Mikroanatomi Pankreas Kodok Lembu Menggunakan Metode Pewarnaan Baku dan Immunohistokimia (MICROSCOPICAL STUDY OF PANCREAS OF BULLFROG USING CONVENTIONAL AND IMMUNOSTAINING METHODS) Adnyane, I Ketut Mudite; ., Supratikno; Winarto, Adi; Agungpriyono, Srihadi
Jurnal Veteriner Vol 12 No 1 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (352.423 KB)


Morphology, distribution and relative frequency of endocrine cells in the pancreas Bullfrog (Ranacatesbeiana) were studied using conventional and immunohistochemical methods. Samples pancreas takenfrom ten adult Bullfrogs (five males and five females). In general, pancreas of the Bullfrog consists ofexocrine portion, endocrine portion (Langerhans islets) and ducts. The Langerhans islets were distributedamong the exocrine portion of pancreas. Endocrine cells in the pancreas of Bullfrog were polimorph, round,oval or triangular in shapes with bipolar cytoplasmic granules. Glucagon cells were distributed mainly inthe peripheral, insulin cells in the center while the somatostatin cells in the area between glucagon andinsulin cells of Langerhans islet. The number of the glucagon cells were higher compare to the number ofinsulin and somatostatin cells.
Mekanisme Peningkatan Heat Shock Protein-70 pada Kanker Payudara Tikus yang Diradiasi, Pascapemberian Ekstrak Meniran (Phyllanthus niruri) (MECHANISM OF INCREASING OF HSP-70 ON IRRADIATED RAT BREAST CANCER, DUE TO APPLICATION OF EXTRACT OF PHYLLANTHUS NIR Soeprijanto, Bambang; Assegaf, Juliati Hood
Jurnal Veteriner Vol 15 No 3 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (208.277 KB)


The used of radiation as a cancer treatment is also proven giving the side effect of damaging thenormal tissue. The extract of Phyllanthus niruri L plant has already been known have an ability to modulatethe immune system. Heat Shock Protein 70 (HSP70) is a protein which can protect other proteins from anydamages. The transcription factor, such as Nuclear factor kappa-light-chain-enhancer of activated B cells(NfkB),is required for protein synthesis. This research was intended to analyze the mechanism, of the immunecompetent cells in expressing the HSP70,through the increase of Nf-kB, at the rat breast cancer tissueunder radiation, due to the application of the extract of P.niruri L plant. An experimental study wasperformed by using the randomized separate pre-test post test controlled group design. The female whiterat (Rattus norvegicus) strain Sprague Dawleystrain, undergoing breast cancer due to the application ofcarcinogen materials 7,12-dimethylbenz(a)antrasen(DMBA) at 20 mg/kg.b.wt, and then the externalradiation at 6Gy given. The treatment group was given the aqueous extract of P.niruri L plant per oral at250 mg/kg b.wt.By immunohistochemistry and t-test study we observe a significant increases in thenumber of cells expressing Nf-kB (p<0.05) and a significant increases in the number of cells expressingHSP70 (p<0.05) at the treatment group. At the regression test, there found to be a stronger influence of NfkBto HSP70 at the treatment group. It is concluded that the mechanism of cell increase expressing theHSP70 at the rat breast cancer tissue under radiation due to the application of the aqueous extract ofP.niruri L plant per oral, is through the increase of cells expressing the Nf-kB.
Seroprevalensi yang Tinggi dan Faktor-Faktor Risiko Toksoplasmosis pada Darah Donor dan Wanita di Bali (HIGH SEROPREVALENCE AND RISK FACTORS OF TOKSOPLASMOSIS AMONG BLOOD DONORS AND WOMEN IN BALI) Laksemi, Dewa Ayu Agus Sri; Artama, Wayan Tunas; Wijayanti, Mahardika Agus
Jurnal Veteriner Vol 14 No 2 (2013)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (124.775 KB)


Toxoplasmosis is an important public health problem because of its worldwide distribution, economicand social impact due to high sequele that may cause such as mental retardation and blindness in children.The aims of this study were to asses serological prevalence of toxoplasmosis in donors and women in Baliand get an overview of association between risk factors and toxoplasmosis infection, i.e.: comprising catownership, food pattern, occupation related to contact with raw meat and activities related to contact withsoil. Serum samples were collected from donors consecutively, while simple cluster design was used forsampling woman. Data on demographics and risk factors for toxoplasmosis were obtained usingquestionnaire. Serological prevalence of toxoplasmosis in donors was 35,9%, while in women was 63.9%.Serological prevalence of toxoplasmosis  in donors at District Badung was 29,2%, Tabanan 36.8%, Gianyar25.0%, Denpasar 41.1%, Klungkung 25.0%, and Bangli 8.3%. Serological prevalence of toxoplasmosis  inwomen at District Badung was 33.3%, Tabanan 66.5%, Gianyar 82.5%, Denpasar 71.1%, Klungkung 81.5%and Bangli 16.7%. Risk factor that play a role in toxoplasmosis infection were food pattern and occupationrelated to contact with soil. The seroprevalence of toxoplasmosis in voluntary blood donors and child-bearing age is relatively high due to local habbit of Balinese society that consume raw meat called lawarand sate
Distribusi Simulium Spp. (Diptera: Simuliidae) Pradewasa pada Kualitas Air dan Karakteristik Fisik Sungai Berbeda di Kabupaten Bogor Nur Rustam, Sri Nur Rahmi; Hadi, Upik Kesumawati; Soviana, Susi
Jurnal Veteriner Vol 20 No 4 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (159.579 KB) | DOI: 10.19087/jveteriner.2019.20.4.511


Simulium (black flies) are vector of Onchocerciasis in humans and animals. Preimaginal Simulium has most typical breeding habitat in clear water with fast-running water. This study aims to analyze the relationship between distribution of preimaginal Simulium with the water quality and the rivers physical characteristics. The study was conducted on October 2018 until January 2019 in three locations namely Cilember 1 and Cilember 2 (forest areas), and Pamijahan (rural area), Bogor Regency, West Java. Preimaginal Simulium collections, water quality, and rivers physical characteristics measurements were carried twice a month during four months. Identification was carried out under a microscope, and the data was analyzed by canonical correspondence analysis (CCA). The results showed that the distribution of preimaginal Simulium species in the forest areas (Cilember 1 and 2) were more diverse than in the rural area (Pamijahan). Seven species of black flies were found in Cilember 1, four species in Cilember 2, and two species in Pamijahan. The most abundance of black fly species found in Cilember 1 was S. (S.) eximium (43.25%), in Cilember 2 was S. (N.) feuerborni (88.71%), and in Pamijahan was S. (S.) nobile (99.12%). Based on CCA preimaginal Simulium species with high diversity were found in the rivers that have high dissolved oxygen (9.35±0.32 mg/L), low temperature (19.94±0.24ºC), low total dissolved solid (17.45±1.90 ppm), low conductivity (25.48±2.34 ?s), and low concentration of Coliform (0.43×103±0.25 cfu/ mL), and the physical characteristics of the rivers were wide (3.68 m), fast running-water (1.00±0.09 m/s), depth more than 0.1 m, and boulder streambed particles.
Kepadatan dan Kekuatan Tulang Sapi Bali Betina yang Dipelihara Masyarakat di Bali (THE DENSITY AND STRENGTH OF FEMALE BALI CATTLE BONE REARING BY BALINESE COMMUNITY) Batan, I Wayan; Fanggidae, Betharia Criselda; Suatha, I Ketut; Suarsana, I Nyoman
Jurnal Veteriner Vol 19 No 3 (2018)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (106.545 KB)


Bali cattle (Bos (Bibos) banteng) often experience fractures (fractures) of metacarpale, femur bone or tibia-fibular bone. This study was aim to reveal the strength and density of female Bali cattle bone which determines the occurrence of fractures. In order to reveal the strength of bali cattle bones, the elements that need to be explored include: bone density, cortical thickness of tibia bone, bone diameter, and bone resistance to pressure. To determine bone density performed by measuring bone specific graavity, cortical thickness of bone, carried out by splitting the bone by sawing the tibia bone extensively, then measuring the thickness of the wall of the bone cylinder using a caliper. Measurement of bone resistance to pressure was done by weighing the bone with a certain weight until the bone breaks or cracks and then measured by checking in which load the bones breaks or cracks. The result shown that the average density of Bali cow os tibia is 1.95 g/mL, average os tibia diameter is 26.45 mm, os tibia cortical thickness from top, middle, and bottom in sequence are 5.50 mm, 6.25 mm, and 5.35 mm. The result of os tibia compressive strength test is 9.26 Pascal with average load can be hold is 56.75 Newton and average wide of os tibia cross section cut is 6.05 cm2. This study result can be used as representation of Bali cow os tibia strength that has not been widely reported and can be used as recommendation for improvement of female Bali cattle livestock management.
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER Suartha, I Nyoman; Mahardika, I Gusti Ngurah Kade; Sri Candra Dewi, Ida Ayu; Dias Nursanty, Ni Ketut; L.S Kote, Yosaphat; Dwi Handayani, Anita; Ayu Suartini, I Gusti Agung
Jurnal Veteriner Vol 9 No 1 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar


A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Pemanfaatan Electronic Nose sebagai Sensor Kimiawi Urin Guna Melacak Birahi Sapi (ELECTRONIC NOSE AS URINARY CHEMICAL SENSOR FOR DETERMINING ESTROUS PHASE IN CATTLE) Astuti, Pudji; Airin, Claude Mona; Widiyanto, Slamet; Sjahfirdi, Luthfiralda; Maheshwari, Hera
Jurnal Veteriner Vol 17 No 4 (2016)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (206.873 KB)


The timing of artificial insemination relies largely on behavioral observation of estrus. The problemfaced is that not all cattle shows signs of estrus significantly, which affect the accuracy of insemination,and therefore,the success rate of Artificial Insemination is less than 50%. Recently, the determination ofestradiol levels as an indicator of estrus is done by observation of physical signs and doing ELISA test,which is expensive and provide longer time. In order to solve these problems, a tool estrus detector is madenamely Electronic Nose (EN). Determination of estrus with EN is cheaper because it does not need to usecomplexmaterials, just only use the samples. Mechanism of action of EN is using a sensor that is vaporized,while animals estrus will emit pheromones that are vaporized. Theaim of this study was to determinewhether the stage of estrus can be detected by using EN. Urine of female Ongole Crossbred which maintainedin Kuwang, district of Cangkringan, Yogyakarta, with BCS of 3 was used in this research. The sample wascollected shortly before injection of dinoprost as estrus synchronization then it repeated when cattle got estrus phase. The urinary sample of the estrus cattle was sensitive to methane, propane, butane, whereasin non-estrus cattle, besides the three of these component (methane, propane, butane), sensor was alsocaptured hydrogen sulfide. Furthermore, our electronic nose had been able to distinguish estrus phase andnon-estrus based on domain area.Thus, the Electronic Nose is very prospect used as a detector of estrus incattle. Hydrogen disulfide could possibly be used as an indicator comparison between cow estrus and nonestrus.

Page 1 of 93 | Total Record : 922